Чем лечат лямблии у детей: Лямблиоз у детей — причины, симптомы, диагностика и лечение лямблиоза у детей в Москве в детской клинике «СМ-Доктор»

Содержание

Лямблиоз у детей: симптомы, лечение

Лямблиоз – это кишечная инфекция, которая в острой форме протекает соответственно своему определению, то есть с повышением температуры до 37.5 – 38.5 градусов, тошнотой, рвотой, болями в животе и жидким стулом – поносом.

В домашних условиях лямблиоз чаще всего родители заболевшего ребенка, а также и участковый врач педиатр примут за обычную кишечную, читай – ротавирусную инфекцию, частота и распространенность которой действительно выше, чем лямблиоза.

Собственно говоря, редкий доктор назначит температурящему и поносящему ребенку копрологию, а если и назначит, то редкий родитель потащится утром перед работой с детскими фекалиями в лабораторию, ведь проще истребовать с лечащего доктора какой-нибудь кишечный препарат, который снимет все симптомы за 2 – 3 дня. А если будет выявлен лямблиоз, то это – экстренное извещение в Роспотребнадзор, и ребенок зависнет дома еще недели на 2, пока не будет получен трехкратный отрицательный результат.

Так что диагноз лямблиоз в обычной практике – это «случайная» находка во время госпитализации в инфекционное отделение.

Лямблиоз у детей – течение хронического заболевания

Установлено, что у большинства лиц, зараженных лямблиями, наблюдаетсяили малосимптомное течение лямблиоза, или вообще практически скрытное, без клинических проявлений. Отсюда и сложности в диагностике.

Хронический лямблиоз чаще поражает детей дошкольного и раннего школьного возраста, при этом у заболевшего ребенка может наблюдаться целый «букет» малоспецифичных жалоб:

— на боли в животе

— быструю утомляемость

— плохой аппетит

— сухость кожи, трещины губ, особенно в углах рта, плохой запах изо рта, налет на языке и т.д.

Из явных признаков поражения желудочно-кишечного тракта можно выделить повышенное газообразование и вздутие живота, периодические боли в животе, чередование нарушений стула от поноса к запорам.

Тем не менее, есть куча других заболеваний, о которых сначала подумает доктор при наличии указанных жалоб, прежде чем речь зайдет о лямблиозе.

Кстати говоря, еще одним обстоятельством, которое может и должно заставить лечащего врача подумать о хроническом лямблиозе, является неожиданно возникшая у ребенка на «пустом месте» аллергия. Конечно я утрирую, пустого места никогда не бывает, но если у ребенка в 13 лет, который никогда раньше не страдал никакой аллергией, вдруг появится острая распространенная крапивница, да еще с отеком Квинке, и которая будет очень долго и нудно уходить даже под воздействием сильнодействующих гормональных препаратов, есть очень твердый повод обследовать ребенка на лямблиоз.

Хронический лямблиоз у детей, диагностика

Основным, хотя и далеко не самым эффективным методом диагностики лямблиоза является обычная копрология, то есть исследование кала под микроскопом.

В реальной клинической практике только копрология в сочетании с анализом крови методом ИФА на антитела к лямблиям может помочь в выявлении этой весьма неприятной проблемы.

Золотым же стандартом в диагностике хронического лямблиоза является гастродуоденоеюноскопия (тот самый «шланг, который глотает пациент») с биопсией слизистой оболочки тонкой кишки и забором на анализ желчи из желчного пузыря.

Таким образом, однократный анализ кала на копрограмму может и не дать никакого результата, если процедура совпала со стадией заболевания, когда не происходит выделение цист возбудителя в просвет кишки, поэтому при получении отрицательного результата при исследовании кала нужно назначить повторно еще 3 или 4 исследования с интервалом в 1 неделю.

Лечение лямблиоза – это довольно длительный процесс, причем запомните, что нельзя вылечить лямблиоз одним препаратом, кто бы и что Вам не говорил. Для гарантированного излечения от лямблиоза требуется комбинация препаратов, действующих как на половозрелые особи лямблий, так и на цисты и споры – спящую и самую трудноизлечимую форму этого паразита. С учетом довольно серьезных побочных эффектов от препаратов, используемых при лечении лямблиоза у детей, крайне желательно добиться получения близкого к 100% подтвержденного диагноза хронического лямблиоза перед тем, как начинать с ним бороться, а кроме этого, также необходимо обследовать всех членов семьи больного ребенка, чтобы избежать впоследствии повторного инфицирования.

Лямблии у детей — ПЕАН

Впервые лямблии у детей были выделены из кала около ста пятидесяти лет назад. Изначально считаясь детским недугом, лямблиоз в последующем был зафиксирован и у взрослых людей, однако заражаемость лямблиями у детей выше, в виду чего данными паразитами поражена большая часть детского населения планеты. Лямблии представляют собой простейших, которые проникают в тонкий кишечник человека, вызывая расстройство пищеварения. Бессимптомное протекание лямблиоза, именуемое лямблионосительством, характерно только для взрослых людей, в то время как у детей течение болезни сопровождается рядом характерных симптомов.

Жизненный цикл паразитов состоит из двух стадий: вегетативной, когда их жизнедеятельность не ограничивается внешними факторами, и покоящейся, когда лямблии длительное время пребывают в «законсервированном» состоянии, превращаясь при определенных условиях в трофозоиды. Попав в организм, лямблии у детей, также как и у взрослых стремительно проникают в кишечник, где прикрепляются к клеткам слизистой оболочки для возможности высасывания из них питательных веществ, не вызывая при этом структурных повреждений. Лямблии, находящиеся в вегетативной стадии, могут быть обнаружены только в жидком, свежесобранном кале, в остальных случаях они превращаются в цисты, выделяющиеся с каловыми массами.

В виду того, что лямблии являются видовыми паразитами, источником их распространения является непосредственно больной человек. Выделяя с калом большое количество цист лямблий, через бытовые предметы, грязные руки и насекомых происходит передача паразитов другим людям. Цисты лямблий вне организма сохраняют жизнедеятельность в течение трех недель, а во влажных условиях и затемненных местах их выживаемость увеличивается до семидесяти дней. Лямблии могут также прожить и в почве в пределах девяти-двенадцати суток, а в случае недостаточной влажности – четырех-пяти дней, в виду чего данные паразиты распространены повсеместно, ежегодно поражая все больше людей.

Попав в организм очередного хозяина, лямблии перевоплощаются в трофозоиды и живут в кишечнике от двух до сорока дней. Несмотря на короткий срок жизнедеятельности, лямблиоз может протекать достаточно длительно, в виду постоянно повторяющегося процесса самозаражения. У малышей массивная инвазия лямблиями вызывает выраженные проявления, так как зачастую кишечник ребенка бывает переполнен паразитами . При лямблиозе у детей происходит нарушение кишечного всасывания, которое проявляется постоянной диареей с повышенным содержанием в кале не всосавшегося жира. В случае, когда лямблии у детей заполоняют весь кишечник, ребенок начинает терять в весе, отставать в росте, у него развивается малокровие и обезвоживание, а также появляется сухость кожных покровов.

Общей симптоматикой наличия в организме паразитирующих лямблий являются: утомляемость, слабость, снижение аппетита, раздражительность, головокружение, головные боли, урчание в кишечнике, метеоризм, вздутие живота, болезненность живота при пальпации особенно в правом подреберье, плохой сон, увеличение печени, неустойчивый стул с чередующимися диареей и запорами, анемия и дисбактериоз кишечника. Со стороны кожных покровов отмечаются неравномерность окраски живота, кожи шеи и подмышечных складок; бледность, в особенности кожи на лице; поражение губ; сухость и появление «гусиной кожи» с локализацией на боковых поверхностях живота, а также на руках и ногах; атопический дерматит.

Зачастую лямблии у детей вызывают нарушения функций тонкой кишки, которые первоначально протекают незаметно. В последующем происходит повышение температуры тела, появляется вздутие живота, чередование запоров и диареи при общем снижении аппетита. Также возможно появление болевых ощущений в области живота, появляющихся в виде периодических приступов. Отягощая течение болезней желудочно-кишечного тракта, лямблиоз в то же время маскирует их, в виду чего диагностировать такие состояния как дискенезия желчного пузыря или воспалительный процесс в поджелудочной железе не представляется возможным. В связи с этим, в случае появления у ребенка характерных жалоб и выявления лямблий в кале необходимо произвести дополнительное обследование, для определения скрыто протекающих воспалительных болезней желудочно-кишечного тракта. Диагноз лямблиоза у детей может быть поставлен на основании проведенных микроскопических исследований мазков испражнений. Трофозоиды чаще всего обнаруживаются в содержимом двенадцатиперстной кишки при осуществлении зондирования и в жидком кале в случае диареи, в то время как цисты можно выявить только в оформленном кале.

Лечение лямблиоза необходимо осуществлять незамедлительно, дабы не допустить того, чтобы лямблии у детей заполнили большую часть кишечника, вызывая нарушения в функционировании организма. Самыми распространенными средствами лечения лямблиоза у малышей являются фурозолидон и метронидазол, иначе известный, как трихопол. Курс лечения данными препаратами в большинстве случаев продолжается около недели, однако при необходимости через месяц можно произвести повторный курс. В случае лабораторного подтверждения наличия в детском организме лямблий, малышам назначается диета, ограничивающая сладкое и мучное; препараты, которые способствуют нормализации микрофлоры кишечника при общем оздоровлении его состояния; витамины с рядом полезных для организма микро- и макроэлементов.

Лечение должно производиться только в том случае, когда лямблии у детей были подтверждены лабораторным путем, в виду того, что при лямблионосительстве необходимости в лечении с ограничивающим питанием нет, достаточно лишь соблюдать правила гигиены, дабы предотвратить самозаражение. Несмотря на то, что лямблиоз не является тяжелым заболеванием, он может стать основой для развития аллергических реакций либо скрывать за собой опасные своими последствиями болезни органов пищеварения. В качестве профилактических мероприятий для предотвращения заражения лямблиями важно использовать для питья и приготовления пищи только фильтрованную либо кипяченую воду; в случае наличия в помещении животных проводить противолямблиозные и антигельминтные обработки, а также не пренебрегать правилами личной гигиены, не забывая о путях передачи лямблий.

Лямблиоз у детей — Мы лечим

Лямблиоз – это паразитарное заболевание, поражающее желудочно-кишечный тракт человека. Его возбудителем является внутриклеточный паразит, обитающий в микроворсинках тонкой кишки и желчном пузыре. Заражение лямблиями у детей приводит к нарушению нормальной работы желудочно-кишечного тракта и гепатобилиарной системы.

Специалисты клиники «Доктор Чой» применяют современные европейские медицинские методики наряду с традиционными восточными практиками, что позволяет как выявить лямблии у ребенка, так и быстро устранить нарушение. При этом оказывается комплексное укрепляющее воздействие, стимулируется иммунитет маленького пациента, и предупреждаются многие заболевания, которые могли бы развиться впоследствии.

Как происходит заражение

Заражение лямблиями у детей происходит фекально-оральным путем. Паразиты попадают в окружающую среду из кала больного ребенка или носителя, после чего заносятся в организм здорового малыша с грязными руками, пищей, предметами обихода. Болезнь развивается при одновременном проглатывании 12 и более цист возбудителя. Паразиты лямблии у детей быстро проникают в кишечник и желчевыводящие пути, активно колонизируя их.

На практике малыши чаще всего заражаются во время пребывания на улице и игр с игрушками. Попадание паразитов в организм возможно также при использовании чужих полотенец в детских садиках, употреблении не кипяченой воды из-под крана, не мытых овощей и фруктов. Гораздо реже болезнь передается от больной матери. В этом случае дети заражаются лямблиозом через материнское молоко.

Формы и симптомы лямблиоза у детей

Лямблиоз может иметь острое или хроническое течение. Примерно в 30% случаев встречается бессимптомное носительство. Заболевание может протекать в разных клинических формах и иметь самые различные симптомы.

В зависимости от того, как проявляются лямблии у ребенка, симптомы и лечение несколько различаются. При остром течении болезни у ребенка наблюдаются:

  • резкое повышение температуры тела,
  • боли и вздутие живота,
  • диарея.

При хроническом лямблиозе на первый план выходят несильные ноющие боли и дискомфорт в эпигастрии (район свода ребер) и правом подреберье, регулярные запоры или поносы.

Для кишечной формы болезни характерно поражение верхнего отдела тонкого кишечника. Вследствие этого у ребенка нарушается всасывание питательных веществ, что приводит к затруднённому усвоению пищи, появлению анемии, слабости, бледности, быстрой утомляемости.

При гепатобилиарной форме страдает печень и желчевыводящие пути. Из-за этого у малыша развивается дискинезия желчного пузыря и застой желчи. У ребенка с токсико-аллергической формой лямблиоза появляются высыпания по типу крапивницы и аллергический отек Квинке.

Другие возможные признаки лямблиоза у детей:

  • раздражительность, плохой сон, частые головокружения;
  • бледность, сухость кожных покровов на конечностях;
  • снижение аппетита, частые приступы тошноты;
  • неравномерная окраска кожи на боковых поверхностях живота, шее, под мышками.

К сожалению, характерных симптомов болезни не достаточно для постановки диагноза. Так как обнаружить лямблии у ребенка можно лишь с помощью лабораторных методов исследования, обращение к врачу неизбежно.

Методы диагностики болезни

Одним из наиболее простых и доступных методов диагностики у детей является анализ кала на лямблии. В ходе исследования лаборант обнаруживает в исследуемом материале цисты возбудителя, которые указывают на наличие болезни или скрытого носительства. К сожалению, этот анализ не дает полностью достоверных результатов.

Намного информативней исследование крови у детей на наличие антител к лямблиям. ПЦР позволяет выявить иммуноглобулины класса G при хроническом течении болезни и IgM при остром лямблиозе.

Лямблии в печени у детей можно обнаружить с помощью дуоденального зондирования. В ходе исследования получают желчь ребенка, которую затем исследуют на наличие паразитов. К сожалению, данная методика достаточно сложна в применении и сильно пугает малышей, из-за чего в диагностических целях используется крайне редко.

Для диагностики лямблий у детей в клинике «Доктор Чой» применяется биорезонансное обследование организма. Методика позволяет достоверно определить наличие паразитов, их локализацию в различных органах, степень инфицированности и даже общее состояние здоровья ребенка. Биорезонансная компьютерная диагностика также эффективна в оценке состояния иммунной системы малыша и его способности противостоять инфекциям. Кроме того, такой метод исследование предполагает минимум стресса для маленького пациента.

Как лечить лямблиоз

Так как вылечить лямблии у ребенка достаточно сложно, требуется комплексный подход к борьбе с проблемой. В первую очередь необходимы лекарства, оказывающие противопаразитарное действие. Эти средства позволяют избавиться от лямблий у детей, но не обязательно являются агрессивными медикаментозными препаратами. В качестве лекарства можно использовать специальные целебные травы, индивидуально подбираемые в каждом конкретном случае. Восточной медицине известно немало лечебных растений, которые по эффективности не уступают фармпрепаратам.

В лечение лямблиоза у детей можно включать и другие методики восточной медицины. Они помогают укрепить иммунитет ребенка и повысить его сопротивляемость инфекциям. Иглоукалывание, точечный массаж и специальная гимнастика стимулируют иммунитет малыша, активизируют его организм и помогают быстрее справиться с проблемой.

Чтобы пройти обследование и получить подробную консультацию врача, запишитесь на прием у наших администраторов. В ходе осмотра специалист ответит на все интересующие вас вопросы.

Лямбиоз у детей

Лямблиоз — это паразитарное заболевание, поражающее желудочно-кишечный тракт человека. Его возбудителем является внутриклеточный паразит, обитающий в микроворсинках тонкой кишки и желчном пузыре. Заражение лямблиями у детей приводит к нарушению нормальной работы желудочно-кишечного тракта и гепатобилиарной системы.

Специалисты клиники «ЛЕКАРЬ» применяют современные европейские медицинские методики наряду с традиционными восточными практиками, что позволяет как выявить лямблии у ребенка, так и быстро устранить нарушение. При этом оказывается комплексное укрепляющее воздействие, стимулируется иммунитет маленького пациента, и предупреждаются многие заболевания, которые могли бы развиться впоследствии.

Заражение лямблиями у детей происходит фекально-оральным путем. Паразиты попадают в окружающую среду из кала больного ребенка или носителя, после чего заносятся в организм здорового малыша с грязными руками, пищей, предметами обихода. Болезнь развивается при одновременном проглатывании 12 и более цист возбудителя. Паразиты лямблии у детей быстро проникают в кишечник и желчевыводящие пути, активно колонизируя их.

На практике малыши чаще всего заражаются во время пребывания на улице и игр с игрушками. Попадание паразитов в организм возможно также при использовании чужих полотенец в детских садиках, употреблении не кипяченой воды из-под крана, не мытых овощей и фруктов. Гораздо реже болезнь передается от больной матери. В этом случае дети заражаются лямблиозом через материнское молоко.

Лямблиоз может иметь острое или хроническое течение. Примерно в 30% случаев встречается бессимптомное носительство. Заболевание может протекать в разных клинических формах и иметь самые различные симптомы.

В зависимости от того, как проявляются лямблии у ребенка, симптомы и лечение несколько различаются. При остром течении болезни у ребенка наблюдаются:

  • резкое повышение температуры тела,
  • боли и вздутие живота,
  • диарея.

При хроническом лямблиозе на первый план выходят несильные ноющие боли и дискомфорт в эпигастрии (район свода ребер) и правом подреберье, регулярные запоры или поносы.

Для кишечной формы болезни характерно поражение верхнего отдела тонкого кишечника. Вследствие этого у ребенка нарушается всасывание питательных веществ, что приводит к затруднённому усвоению пищи, появлению анемии, слабости, бледности, быстрой утомляемости.

При гепатобилиарной форме страдает печень и желчевыводящие пути. Из-за этого у малыша развивается дискинезия желчного пузыря и застой желчи. У ребенка с токсико-аллергической формой лямблиоза появляются высыпания по типу крапивницы и аллергический отек Квинке.

Другие возможные признаки лямблиоза у детей:

  • раздражительность, плохой сон, частые головокружения;
  • бледность, сухость кожных покровов на конечностях;
  • снижение аппетита, частые приступы тошноты;
  • неравномерная окраска кожи на боковых поверхностях живота, шее, под мышками.

К сожалению, характерных симптомов болезни не достаточно для постановки диагноза. Так как обнаружить лямблии у ребенка можно лишь с помощью лабораторных методов исследования, обращение к врачу неизбежно.

Одним из наиболее простых и доступных методов диагностики у детей является анализ кала на лямблии. В ходе исследования лаборант обнаруживает в исследуемом материале цисты возбудителя, которые указывают на наличие болезни или скрытого носительства. К сожалению, этот анализ не дает полностью достоверных результатов.

Намного информативней исследование крови у детей на наличие антител к лямблиям. ПЦР позволяет выявить иммуноглобулины класса G при хроническом течении болезни и IgM при остром лямблиозе.

Лямблии в печени у детей можно обнаружить с помощью дуоденального зондирования. В ходе исследования получают желчь ребенка, которую затем исследуют на наличие паразитов. К сожалению, данная методика достаточно сложна в применении и сильно пугает малышей, из-за чего в диагностических целях используется крайне редко.

Для диагностики лямблий у детей в клинике «ЛЕКАРЬ» применяется биорезонансное обследование организма. Методика позволяет достоверно определить наличие паразитов, их локализацию в различных органах, степень инфицированности и даже общее состояние здоровья ребенка. Биорезонансная компьютерная диагностика также эффективна в оценке состояния иммунной системы малыша и его способности противостоять инфекциям. Кроме того, такой метод исследование предполагает минимум стресса для маленького пациента.

Так как вылечить лямблии у ребенка достаточно сложно, требуется комплексный подход к борьбе с проблемой. В первую очередь необходимы лекарства, оказывающие противопаразитарное действие. Эти средства позволяют избавиться от лямблий у детей, но не обязательно являются агрессивными медикаментозными препаратами. В качестве лекарства можно использовать специальные целебные травы, индивидуально подбираемые в каждом конкретном случае. Восточной медицине известно немало лечебных растений, которые по эффективности не уступают фармпрепаратам.

В лечение лямблиоза у детей можно включать и другие методики восточной медицины. Они помогают укрепить иммунитет ребенка и повысить его сопротивляемость инфекциям. Иглоукалывание, точечный массаж и специальная гимнастика стимулируют иммунитет малыша, активизируют его организм и помогают быстрее справиться с проблемой.

Чтобы пройти обследование и получить подробную консультацию врача, запишитесь на прием у наших администраторов. В ходе осмотра специалист ответит на все интересующие вас вопросы.

лечение народными средствами и традиционными методами, причины появления, симптомы, методы исследования, лечение и профилактика заболевания

Прежде чем определить, как избавиться от лямблий в домашних условиях, нужно совершенно точно знать, что такое лямблиоз и как именно он проявляется. Это довольно распространенная паразитическая болезнь, которая сопровождается нарушением функционирования кишечника. Диагностировать лямблиоз не всегда получается сразу. Многие считают, что ребенок просто чем-то отравился, так как у него отсутствует аппетит и наблюдается понос. Важно своевременно диагностировать болезнь и провести лечение.

Что такое лямблии?

Очень важно знать не только о том, как избавиться от лямблий в домашних условиях, но и что именно представляют собой эти паразиты и как они влияют на детский организм. Лямблии имеют две формы развития — трофозоит и циста. Трофозоит – активная разновидность паразита, имеющая грушеобразную форму. Их туловище состоит из 4 пар жгутиков и присоски для прикрепления к кишечнику.

Этот паразит не имеет ротовой полости, поэтому он питается только растворенными полезными веществами, поступающими в желудок. Присутствие большого количества лямблий и продуктов их жизнедеятельности могут спровоцировать нарушение процесса всасывания. Прикрепляясь к стенкам кишечника, паразиты значительно ухудшают всасывание углеводов, жиров, витаминов, а также снижают активность ферментов. В результате этого значительно ухудшается обмен веществ, обнаруживаются признаки дисбактериоза, болезненные ощущения в области кишечника, тошнота.

В зависимости от особенности проявления болезни, симптоматика может несколько различаться. Единственным благоприятным местом для жизнедеятельности лямблий считается тонкий кишечник.

Размножение лямблий происходит путем деления особи, а возможно это только при требуемых условиях. При ухудшении питания ребенка, повышенном содержании желчи и голодании начинается цистирование паразита. Форма у этого вида возбудителя выполняет защитную функцию и служит для дальнейшего распространения инфекции. Образование цист происходит в ободочной кишке, а затем они выходят вместе с калом. Для заражения организма требуется всего лишь 10 цист.

Лямблиоз у грудничков

Достаточно часто диагностируются случаи лямблиоза у грудничков. Первые признаки появляются на этапе грудного вскармливания. Основными симптомами считаются:

  • отказ от потребления пищи;
  • плаксивость;
  • повышение температуры;
  • дисбактериоз;
  • сильный понос;
  • замедление физического развития;
  • аллергия.

Проникновение лямблий в организм грудничка происходит только по причине недостаточно хорошего ухода за малышом. В случае появления всех этих признаков нужно сразу же обратиться к педиатру или инфекционисту. Самостоятельное лечение лямблий в домашних условиях категорически запрещено.

Лямблиоз у детей старше года

Признаки заболевания у детей старше года начинают появляться примерно через 1-2 недели после заражения. За этот период лямблии успевают адаптироваться в организме. Изначально ребенок начинает отказываться от еды, а затем резко худеет, вплоть до полного истощения. По форме протекания лямблиоз может быть острым и хроническим. Обязательно проводится лечение обеих этих форм болезни.

Основными симптомами острого лямблиоза считаются:

  • частая дефекация жидкими и зловонными каловыми массами;
  • боли в животе;
  • лихорадка;
  • аллергия;
  • слабость.

Без требуемого лечения признаки болезни начинают постепенно угасать и болезнь переходит в хроническую стадию. Основными симптомами считаются:

  • гастродуоденит;
  • нарушение пищеварения;
  • вздутие живота;
  • боль в животе;
  • многократный понос.

Существует также целый ряд многих других характерных симптомов у ребенка старше года. Среди них нужно выделить такие, как:

  • продолжительная диарея;
  • повышение температуры;
  • лихорадка;
  • острые боли в области пупка;
  • появление зудящей сыпи;
  • тошнота.

У ребенка каловые массы имеют очень резкий, неприятный запах и прилипают к стенкам унитаза, так как организмом не перевариваются жиры. Кроме того, озноб чередуется с жаром. На фоне всех этих признаков происходит резкое снижение веса, что приводит к истощению.

Лямблиоз у подростков

При инфицировании лямблиями в подростковом возрасте болезнь проявляется в виде вегетативных нарушений в организме:

  • перепады давления;
  • ринит;
  • головокружение;
  • укачивание в транспорте.

При тяжелых болезнях кишечной формы, когда в организм проникло много паразитов, иногда возникают кишечные кризы, что сопровождается схваткообразными болями в животе. Зачастую у подростков диагноз может быть ошибочно поставлен, так как эти признаки напоминают гастродуоденит и аппендицит. Нередко симптомы лямблиоза путают с дискинезиями желчных путей.

При лямблиозе довольно часто наблюдается кашель и высыпания на коже. Подобные проявления связывают с наличием аллергии на токсины, которые выделяют паразиты. Это своего рода защита организма человека от паразитарной инфекции.

В некоторых случаях у подростков наблюдается одышка, что многие родители принимают за признаки астмы или простуды и начинают их безуспешно лечить. Чтобы вывести лямблии в домашних условиях, лечение должно быть комплексное. Очень важно провести своевременную диагностику, особенно если имеются характерные признаки болезни.

Способы заражения

Количество лямблий во многом зависит от степени заражения и потребляемой ребенком пищи. Чем дольше заражен малыш, тем большее количество паразитов он выделяет во внешнюю среду. Основным источником заражения выступает инфицированный человек. Способ заражения — фекально-оральный. Различают 3 основных способа передачи болезни:

  • пищевой;
  • водный;
  • контактно-бытовой.

Пищевой способ заражения характеризуется тем, что передача цист происходит вместе с продуктами питания. На них гельминты живут от 6 часов до 2 дней. Источниками заражения могут служить:

  • плохо вымытые или немытые фрукты, овощи и ягоды;
  • недоваренное или недожаренное мясо;
  • продукты, зараженные тараканами или мухами.

Зачастую заражение происходит при потреблении сырой воды. Во влажной среде лямблии живут 2-3 месяца. Заражение происходит:

  • через некипяченую питьевую воду;
  • фрукты и овощи, вымытые водой из-под крана;
  • при плавании в открытом водоеме.

При контактно-бытовом способе передача паразитов происходит от одного ребенка к другому в детских садах и школах. В основном цисты содержатся в песочницах или в удобренной навозом почве. Причинами заражения становятся:

  • антисанитарные условия проживания;
  • использование зараженных предметов;
  • инфицирование ребенка при родах;
  • игры с котами и собаками во дворе.

Кроме того, в качестве причин заражения может выступать наличие вредных привычек, в частности таких, как сосание пальцев ребенком. Стоит отметить, что в соленой морской воде лямблии не обитают.

Основные симптомы

Определить, как лечить лямблии в домашних условиях, может врач, так как самолечение может только лишь навредить. Именно поэтому при возникновении признаков заболевания нужно сразу же посетить педиатра. Клиническая картина лямблиоза схожа с проявлениями других патологических процессов. Родителям нужно знать признаки заражения лямблиями, чтобы можно было своевременно обратиться за помощью. Среди основных проявлений выделяют:

  • отрыжку, горечь во рту, изжогу;
  • жидкий стул с неприятным запахом;
  • тошноту;
  • вздутие живота;
  • боли в области пупка и под ребрами;
  • плохой аппетит;
  • аллергию;
  • головную боль, головокружение;
  • быструю утомляемость.

Если в организме ребенка очень большое количество лямблий, то это провоцирует острую форму болезни. Возникает она в основном у детей до 3 лет. Объясняется это тем, что у ребенка не достаточно развит иммунитет. Диагностировать лямблиоз зачастую бывает довольно сложно. Ребенка начинают лечить от других заболеваний.

Продолжительное течение болезни приводит к возникновению сильной интоксикации организма, снижению веса, ухудшению иммунитета. У ребенка образуются темные круги под глазами из-за отсутствия нормального всасывания витаминов, которые поступают вместе с питанием.

Проведение диагностики

Чтобы определить, как избавиться от лямблий в домашних условиях, нужно посетить врача, который предварительно проведет комплексную диагностику и подберет методики терапии. Если вовремя не выявить лямблиоз, то возможно возникновение опасных последствий. К тому же лечение лямблий у ребенка народными средствами и методами традиционной медицины на ранних стадиях дает намного лучший результат и проходит намного быстрее. Существует несколько методик исследования, что позволит диагностировать зараженность организма. Среди основных методов диагностики выделяют:

  • пальпацию;
  • копрограмму;
  • зондирование;
  • биопсию;
  • иммуноферментный анализ крови.

Изначально врач проводит пальпацию и затем анализирует болезненные ощущения в области кишечника, печени, желчного пузыря. Чтобы определить, как бороться с лямблиями в домашних условиях, нужно провести копрограмму. Это исследование кала, которое позволит обнаружить цисты лямблий. Однако стоит помнить, что оно может показать ложный результат, так как в некоторых случаях паразиты с калом не выделяются. Рекомендуется проведение повторного исследования.

Зондирование применяется для исследования желчевыводящих путей. Подобная методика позволяет обнаружить не только цисты, но и активные формы паразитов. Не исключена также вероятность получения ложного результата. Зондирование проводится только тогда, когда ребенок старше 10 лет. При проведении биопсии изучается слизистая оболочка тонкого кишечника.

Антитела к лямблиям образуются в организме примерно через 2 недели после заражения. Для выявления паразитов назначается ИФА крови. Этот метод дает возможность определить даже примерный период заражения. Кровь из вены сдается строго натощак. Рекомендуется проводить такое исследование одновременно с копрограммой.

Существуют более современные иммунологические методики определения лямблиозных антигенов в каловых массах и антител в тонкой кишке, слюне, сыворотке крови. Они дают хороший результат, но применяются пока очень редко. В основном специалисты прибегают к более простому способу обследования кала.

Для уточнения поставленного диагноза рекомендуется проводить комплексное обследование. В него может входить ультразвуковая диагностика брюшной полости, аллергопробы, анализ кала на дисбактериоз. Такой подход вполне оправдан. Стоит отметить, что кишечные симптомы могут вызывать не только лямблии. Диагностика болезни может давать неправильные результаты, если пациент принимает антибиотики. После исследования подбираются препараты, которые будут результативными и безопасными.

Особенности лечения

Очень серьезное влияние на организм оказывают лямблии. В домашних условиях лямблии вывести можно только при условии проведения комплексной терапии. Лечение лямблиоза имеет ряд характерных особенностей. Симптомы болезни могут быть острыми или хроническими, поэтому схема терапии будет несколько отличаться. Инкубационный период продолжается в течение 1-2 недели. Весь комплекс терапии состоит из нескольких этапов.

Подготовительный этап включает в себя соблюдение диеты с ограничением потребления углеводов, прием антигистаминных, желчегонных препаратов. Направлен он на создание условий, ухудшающих процесс размножения возбудителя. Это время занимает примерно 1-2 недели.

Терапия медикаментозными препаратами подразумевает прием антигистаминных средств, энтеросорбентов, которые помогают вывести токсины и устранить аллергическую реакцию. Этот этап лечения занимает примерно 5-10 дней.

Заключительный этап направлен на стимулирование и повышение защитных механизмов иммунитета, стабилизацию микрофлоры кишечника и нормализацию обмена веществ. На этом этапе также показано соблюдение диеты. Она направлена на нормализацию микрофлоры кишечника. Помимо этого, применяются пробиотики. Этот этап занимает 2-3 недели.

Медикаментозная терапия

Лямблиоз считается довольно сложной болезнью, именно поэтому многие родители интересуются тем, как вылечить лямблии в домашних условиях при помощи медикаментозных препаратов и средств народной медицины. Результативно справиться с этим заболеванием помогают такие лекарства, как:

  • «Фуразолидон»;
  • «Метронидазол»;
  • «Макмирор»;
  • «Албендазол»;
  • «Тинидазол».

Стоит отметить, что дозировка медикаментозных средств зависит от возраста ребенка, веса и типа болезни. Самостоятельное назначение лекарства строго запрещено, так как это может нанести вред маленькому пациенту.

Очень опасными для состояния малыша являются лямблии. В домашних условиях лямблии лечатся при помощи препарата «Метронидазол». Это лекарство токсично для анаэробных форм паразитов и оказывает по отношению к ним разрушающее действие. Препарат всасывается в кровь в течение 3 часов. Он отличается высокой степенью проникновения в ткани и жидкости организма и выводится примерно через 9 часов после приема. Стоит отметить, что лекарство вызывает целый ряд побочных проявлений, поэтому принимать его нужно очень осторожно.

Препарат «Немозол» считается одним из самых результативных, и его часто назначают детям. Основным отличием этого лекарственного средства является минимум побочных проявлений. Курс приема лекарства составляет 5 дней. Согласно медицинским данным, этого времени вполне хватает для излечения ребенка.

Препарат «Макмирор» широкого спектра действия. Он не только отрицательно воздействует на лямблии, но и обладает выраженными противогрибковыми и противомикробными качествами. В организме это лекарство не задерживается, поэтому разрешено к применению детям. Выводится вместе с мочой.

Препарат «Тиберал» содержат орнидазол. Он воздействует на лямблий, приводит к нарушению их генетической программы и гибели паразитов. Поэтому медикамент считается довольно результативным при лямблиозе. Принимается однократно в дозировке, назначенной врачом.

Препарат «Декарис» помогает справляться с лямблиями. Он оказывает парализующее воздействие на паразитов и приводит к их быстрой гибели. Принимать его нужно однократно после потребления пищи.

Препарат «Вермокс» относится к антигельминтным лекарствам, но также и устраняет болезнетворные микроорганизмы. В нем содержатся компоненты, нарушающие всасывание глюкозы паразитами, что приводит к их гибели. Зная, чем потравить лямблии в домашних условиях, можно достичь положительного результата. Самостоятельное лечение может привести к различного рода осложнениям.

После начала лечения примерно через 2-3 дня родители могут увидеть улучшение внешнего вида малыша. Если через 5-6 дней самочувствие ребенка начнет ухудшаться, то не стоит беспокоиться, так как это вполне нормальное явление. Это происходит по причине того, что под воздействием медикаментозных препаратов начинается окончательная гибель паразитов в кишечнике малыша. Токсические вещества всасываются в кровь ребенка, чем и ухудшают его самочувствие. Для облегчения лечебного процесса доктор может назначить антигистаминные средства, которые помогают справиться с аллергией и токсинами. Достаточно широко также применяются для лечения лямблий народные методы. Терапия обязательно должна быть комплексной, в противном случае она может затянуться на длительное время.

Народные методики

Многие интересуются тем, как вылечить лямблии в домашних условиях при помощи народных средств и методик. Терапия прежде всего подразумевает правильное питание и применение средств для укрепления иммунитета и улучшения самочувствия. Помимо нормализации питания, нужно применять для лечения лямблий у ребенка народные методы, которые помогут более результативно справиться с паразитами.

Рекомендуется применять смесь семян льна и гвоздики. При помощи этого средства выводим лямблии в домашних условиях очень быстро и результативно. Компоненты в пропорции 10 к 1 измельчаются в кофемолке до получения однородной смеси, которую затем можно добавлять в продукты или принимать в чистом виде на протяжении 1 месяца.

Не менее результативным средством считается чеснок с молоком. Этот народный метод от лямблий очень простой и безопасный, а также помогает быстро вывести паразитов из организма. Для этого нужно измельчить чеснок, добавить его в 1 стакан теплого молока и дать настояться 10 минут. Дать ребенку выпить молоко, а затем он должен полежать не менее 1 часа, поэтому лекарство лучше принимать на ночь. Это очень хороший народный метод для лечения лямблий у взрослых, так как чеснок помогает быстро изгнать паразитов из организма.

Хороший эффект оказывает огуречный напиток. Для его приготовления нужно свежие огурцы порезать на части, залить кипятком и оставить на 2 часа. После этого жидкость следует процедить и давать напиток ребенку в течение дня.

Для лечения лямблий народными средствами у ребенка нужно применять отвар осины. Для его приготовления необходимо измельчить листья, почки и кору дерева. Затем залить 1 ст. л. подготовленного порошка 1 л воды, проварить в течение 30 минут. Процедить, дать остыть, принимать по 1 стакану 2 раза в сутки на протяжении 2 недель.

Для лечения лямблий у ребенка народными средствами применяется также настойка чистотела, однако стоит помнить, что это довольно токсичное средство, именно поэтому применять его нужно осторожно, чтобы не спровоцировать возникновения побочных эффектов.

Для проведения терапии по утрам нужно съедать по горсти калины вместе с косточками, тщательно их пережевывая.

При использовании народных методов от лямблий нужно предварительно проконсультироваться с врачом, чтобы не навредить здоровью малыша.

Проведение профилактики

После проведения лечения лямблий у ребенка народными средствами и медикаментозными препаратами нужно проводить профилактику повторного заражения. В качестве профилактических мероприятий нужно соблюдать правила гигиены.

Ребенок обязательно должен иметь собственное полотенце. Домашние животные должны постоянно проходить специальную антигельминтную обработку. Питьевую воду нужно перед употреблением кипятить. Овощи, зелень и фрукты нужно мыть сначала под проточной водой, а затем обливать кипятком и сушить чистой салфеткой.

Чтобы снизить вероятность развития лямблиоза, нужно соблюдать меры профилактики и регулярно проходить профилактические осмотры у лечащего врача.

Лечение лямблиоза у детей и взрослых Киев, Левый берег

Лямблиоз – это заболевание органов желудочно – кишечного тракта, которое вызывается лямблиями, класса простейшее.

Заражение происходит через воду, пищу, грязные руки. Высокий риск заражения при купании в бассейнах, открытых водоемах.

Заражение и начало болезни при отсутствии ярко выраженной клиники, когда у больных появляется тошнота, снижение аппетита, слабость, утомляемость, реже может наблюдаться рвота, расстройство стула, повышение температуры. Это длиться недолго и заболевание переходит в хроническую форму без ярких специфических симптомов. Кроме того, человек может стать носителем инфекционного начала, бессимптомно! Но он является источником инфекции и может заразить других людей.

Очень часто данное заболевание наблюдается у детей. Ниже приведены основные рекомендации о том, как лечить глисты у детей до 5-ти лет и старше.

  1. Питьевой режим при лечении лямблии у детей. Необходимо помнить, что лечение любого заболевания должно сопровождаться адекватным питьевым режимом. Вода выводит токсины и способствует устранению застоя в желчевыводящих путях и кишечнике, где и обитают данные патогены.
  2. Второй важнейший пункт лечения лямблиоза – это диета питание. Учтите, что богатая углеводами пища (сладкое, мучное) ограниченное количество белков способствует лямблий, что приводит к обострению хронического процесса. К факторам, способствующим развитию лямблиоза можно отнести снижение кислотности желудка, дисбактериоз кишечника (особенно  при частых приемах антибиотикотерапии )

Диета для пациентов с лямблиозом должна включать ряд ограничений: целесообразно на 3-6 месяцев исключить цельное молоко, резко ограничить или исключить продукты, содержащие глютен ( хлебо-булочные и макаронные изделия , все крупы, кроме рисовой, гречневой, и кукурузной), сладкое.

Продукты, которые ухудшают условия размножения лямблий: каши, сухофрукты, овощи, растительные масла.

Очень важное условие лечения лямблиоза – это грамотное очищение органов пищеварения, толстого, тонкого кишечника, печени.

Этот  5-ти дневный курс Вы можете пройти условиях стационара медицинского центра «Альтернатива»

3. Третье условие противолямблиозной терапии эффективные средства и методы которые губят паразита.

В нашей клинике к таким мероприятиям относятся: клизменные процедуры, чаи с противопаразитарными травами, озонотерапия и лечение с помощью Комплекса медицинского экспертного.

Весь этот комплекс способствует гибели одних особей, к ослаблению и неспособностью размножаться других лямблий, что в конечном итоге приводит к излечению болезни.

В конце курса очищения и лечения врач даст Вам рекомендации по питанию и фитотерапии для закрепления эффекта и восстановления функции органов пищеварения. Кроме этого у нас есть 10-ти дневная противопаразитарная программа лечения. Но для этого понадобится предварительная диагностика паразитологии, без этого назначение лечения невозможно. 

Лямблии у ребенка: как лечить?


Лямблиоз — достаточно серьезное паразитарное заболевание. И выявить его с помощью обычного анализа кала довольно трудно. Очень часто врачи пытаются лечить одни заболевания у ребенка, даже не подозревая о том, что основной их причиной являются лямблии. И ишь только грамотный специалист (инфекционист, гастроэнтеролог или паразитолог) может поставить верный диагноз.

Хотим сразу предупредить: из-за того, что лямблии поселяются в верхнем отделе кишечника, ляблиоз лечится сравнительно длительное время.

 

Читай также «Что такое лямблии и откуда они берутся?»

 

Обычно доктор назначает трехступенчатое лечение, к кототому ребенка нужно подготовить. Иначе избавление от лямблий может стать малоэффективным. 

 

Первый этап лечения лямблиоза

Во время этого этапа проводится механическое уничтожение паразитов, устранение токсических веществ жизнедеятельности лямблий и повышение защитных сил детского организма. Обычно лечение на первом этапе занимает 2-4 недели. Маме нужно создать все условия для скорейшего выздоровления крохи. Это, в первую очередь, соблюдение специальной диеты и режима питания. Благодаря этому создаются благоприятные условия для прекращения размножения лябмлий. В меню ребенка включаются продукты, которые называют нутритивными сорбентами: каши, печеные яблоки, груши, сухофрукты, отруби, много овощей в вареном и пропаренном виде, клюква и брусника, растительное масло. Во время этой диеты стоит ограничить потребление чадом углеводов и сахаров, ведь сладкая среда является благоприятной для размножения паразитов. 

 

Также в этот период вводятся лекарственные препараты и отвары желчегонных трав. 
Маме также нужно помнить, что дитю нужно много пить, но минуральная вода при этом не лучший вариант. 

 

Врач може осоветовать провести очистку кишечника ребенка раз в неделю. Лучший способ очистки доктор подбирает индивидуально под маленького пациента, учитывая его возраст. 

 

После того, как кишечник будет очищен, в течение дня  ребенку следует употреблять отварной рис, печеные овощи и фрукты, много жидкости.

 

Второй этап лечения лямблиоза

Этот период длится в среднем 2 недели, в течение которых назначается противопаразитарная терапия. После курса лечение нужно провести желчегонные мероприятия, которые доктор подбирает индивидуально согласно возрасту ребенка. 

 

Читай также «Почему ребенок часто болеет? 7 основных причин»

 

Третий этап лечени лямблиоза

На третьем этапе лечения маме нужно заняться повышением иммунитета своего чада и создать необходимые условия для подавления жизнедеятельности лямблий. Именно поэтому в питании ребенка должны обязательно быть салаты из свеклы, свекольные отвары, морсы из клюквы и брусники.

 

Также не стоит забывать и о фитотерапии. Отвары из березовых почек и толокнянки помогают рарушить цисты лямблий, которые еще остались в кишечнике.

 

Важно!

Цисты лямблий — это временное существование паразитов, которое характеризуется появлением специальной оболочки на лямблиях во время неблагоприятных условий для их жизнедеятельности. В виде цист лямблии могут существовать до нескольких лет.

Лечение лямблиоза у детей: однократная доза тинидазола по сравнению с 3-дневным приемом нитазоксанида

Лямблии лямблии являются одними из самых распространенных кишечных простейших во всем мире и могут вызывать серьезные заболевания, особенно у детей. Хотя соединения 5-нитроимидазола в течение нескольких лет составляли основу лечения лямблиоза, растущее число сообщений о резистентных случаях при применении этих и других антигиардиальных средств вызвало беспокойство и привело к поиску других соединений.Целью настоящего исследования было сравнить эффективность и безопасность при лечении детей, инфицированных G. lamblia, нитазоксанидом в дозе 7,5 мг / кг два раза в день в течение 3 дней и тинидазолом, принимаемым. в разовой дозе 50 мг / кг. В целом в открытое и рандомизированное исследование было включено 166 детей, у каждого из которых было доказано, что они инфицированы G. lamblia при микроскопическом исследовании образца фекалий. Каждому из них назначали нитазоксанид или тинидазол. Родителей каждого пролеченного ребенка попросили собрать два образца фекалий у ребенка через 5-10 дней после завершения лечения для последующего паразитологического наблюдения.Только в том случае, если в обоих образцах после лечения у ребенка не было обнаружено G. lamblia, этот ребенок считался вылеченным. Среди 137 детей, завершивших исследование (74 получали нитазоксанид и 63 получали тинидазол), частота паразитологического излечения после однократной дозы тинидазола была значительно выше, чем после шести доз нитазоксанида (90,5% против 78,4%; P <0,05). ). Оба режима лечения были хорошо приняты и хорошо переносились, сообщалось только о легких, преходящих и самоограничивающихся побочных эффектах.Самый частый симптом при включении, диарея, обычно проходит через 2-6 дней после начала лечения. Хотя нитазоксанид явно менее эффективен, чем тинидазол, он остается хорошим кандидатом для лечения детей с инфекцией G. lamblia.

Лямблиозная инфекция (лямблиоз) — Диагностика и лечение

Диагностика

Чтобы диагностировать лямблиоз (лямблиоз), ваш врач, вероятно, возьмет на анализ образец вашего стула.Для точности вас могут попросить предоставить несколько образцов стула, собранных за определенный период времени. Затем образцы исследуются в лаборатории на наличие паразитов. Тесты стула также могут использоваться для контроля эффективности любого лечения, которое вы получаете.

Лечение

Дети и взрослые, у которых инфекция лямблиоза протекает бессимптомно, обычно не нуждаются в лечении, если только они не могут распространить паразитов. Многие люди, у которых действительно есть проблемы, часто поправляются сами за несколько недель.

Когда признаки и симптомы серьезны или инфекция сохраняется, врачи обычно лечат инфекцию лямблиоза с помощью таких лекарств, как:

  • Метронидазол (Флагил). Метронидазол — наиболее часто используемый антибиотик при инфекции лямблии. Побочные эффекты могут включать тошноту и металлический привкус во рту. Не употребляйте алкоголь во время приема этого лекарства.
  • Тинидазол (Тиндамакс). Тинидазол действует так же, как метронидазол, и имеет многие из тех же побочных эффектов, но его можно назначать однократно.
  • Нитазоксанид (Алиния). Поскольку нитазоксанид выпускается в жидкой форме, детям легче его проглотить. Побочные эффекты могут включать тошноту, газы, желтые глаза и ярко-желтую мочу.

Не существует постоянно рекомендуемых лекарств от инфекции лямблии во время беременности из-за их потенциального вредного воздействия на плод. Если ваши симптомы легкие, ваш врач может порекомендовать отложить лечение до окончания первого триместра или дольше.Если лечение необходимо, обсудите с врачом наиболее подходящий вариант лечения.

Подготовка к приему

Хотя вы можете сначала сообщить о своих симптомах своему семейному врачу, он или она может направить вас к гастроэнтерологу — врачу, который специализируется на заболеваниях пищеварительной системы.

Что вы можете сделать

Перед встречей вы можете написать список ответов на следующие вопросы:

  • Когда появились ваши признаки и симптомы?
  • Что-нибудь делает их лучше или хуже?
  • Вы работаете или живете с маленькими детьми?
  • Какие лекарства и пищевые добавки вы принимаете?

Чего ожидать от врача

Во время медицинского осмотра ваш врач может попросить вас лечь, чтобы он или она могли осторожно надавить на различные части вашего живота, чтобы проверить, нет ли болезненных участков.Он также может проверить ваш рот и кожу на наличие признаков обезвоживания. Вам также могут дать инструкции о том, как сдать образец стула.

16 июля 2021 г.

Показать ссылки

  1. Leder K, et al. Лямблиоз: эпидемиология, клинические проявления и диагностика. https://www.uptodate.com/contents/search. По состоянию на 3 ноября 2020 г.
  2. Паразиты — Лямблии. Центры по контролю и профилактике заболеваний.https://www.cdc.gov/parasites/giardia/index.html. По состоянию на 3 ноября 2020 г.
  3. Левинсон В. и др. Кишечные и урогенитальные простейшие. В кн .: Обзор медицинской микробиологии и иммунологии. 16-е изд. Макгроу Хилл; 2020. https://accessmedicine.mhmedical.com. По состоянию на 3 ноября 2020 г.
  4. Jameson JL, et al., Eds. Протозойные кишечные инфекции и трихомониаз. В: Принципы внутренней медицины Харрисона. 20-е изд. Макгроу Хилл; 2018. https://accessmedicine.mhmedical.com. По состоянию на ноябрь.3 августа 2020 г.
  5. Bartelt LA. Лямблиоз: лечение и профилактика. https://www.uptodate.com/contents/search. По состоянию на 3 ноября 2020 г.

Связанные

Продукты и услуги

Показать больше продуктов и услуг Mayo Clinic

Лямблиозная инфекция (лямблиоз)

Однократная доза тинидазола по сравнению с 3-дневным приемом нитазоксанида

Опубликовано Maney Publishing (c) Ливерпульская школа тропической медицины

Паразитарная инфекция и не только.Current Infectious

Disease Reports, 8, 91–95.

Канэте Р., Эскобедо А. А., Гонзалез М. Э.,

Альмиралл П. и Кантелар Н. (2006). Рандомизированное контролируемое открытое испытание

в течение одного дня с применением

мебендазола в сравнении с однократной дозой тинидазола в

лечении лямблиоза у детей. Текущий

Медицинские исследования и мнения, 22, 2131–2138.

Cedillo-Rivera, R., Chavez, B., Gonza´lez-Robles, A.,

Tapia, A.И Епез-Мулиа, Л. (2002). Эффект нитазоксанида

in vitro против Entamoeba histolytica, Giardia

кишечника и трофозоитов Trichomonas vaginalis.

Журнал микробиологии эукариот, 49, 201–208.

Цимерман, С., Ладейра, М. К. Т. и Юлиано, В. А.

(2003). Бластоцистоз: нитазоксанид как новый терапевтический препарат

. Revista da Sociedade Brasileira de

Medicina Tropical, 36, 415–417.

Коэн, С.А. (2005). Использование нитазоксанида в качестве нового терапевтического средства

для стойкой диареи: перспектива для педиатрии

. Текущее медицинское исследование и заключение

, 21, 999–1004.

Давила-Гутьеррес, К. Э., Васкес, К., Трухильо —

Эрнандес, Б. и Уэрта, М. (2002). Нитазоксанид

по сравнению с хинфамидом и мебендазолом в лечении глистных инфекций

и кишечных

простейших у детей. Американский тропический журнал

Медицина и гигиена, 66, 251–254.

Диас, Э., Мондрагон, Дж., Рамирес, Э. и Бернал, Р.

(2003). Эпидемиология и борьба с кишечными паразитами

с помощью нитазоксанида у детей в Мексике.

Американский журнал тропической медицины и гигиены, 68,

384–385.

Эскобедо, А. А. и Цимерман, С. (2007). Лямблиоз:

обзор фармакотерапии. Заключение эксперта по фармакотерапии

, 8, 1885–1902.

Эскобедо, А. А., Нунэз, Ф. А., Морейра, И., Vega, E.,

Pareja, A. & Almirall, P. (2003). Хлорохин

и альбендазол

в лечении детей

больных лямблиозом. Анналы тропической медицины и

паразитологии, 97, 367–371.

Гарсия, Л. С. и Брукнер, Д. А. (1993). Макроскопическое исследование

и микроскопическое исследование фекалий. В

Диагностическая медицинская паразитология, стр. 501–540.

Вашингтон, округ Колумбия: Американское общество микробиологии.

Газдер, А. Дж. И Банерджи, М. (1978). Разовая доза

Терапия лямблиоза тинидазолом и метронидом-

зол. Лекарства, 15 (Приложение 1), 30–32.

Харрис, Дж. К., Пламмер, С. и Ллойд, Д. (2001).

Антигиардиальные препараты. Прикладная микробиология и

биотехнология, 57, 614–619.

Джокипи А. М. и Йокипи Л. (1977). Предубеждение

лямблий. Ланцет, и, 1095–1097.

Манес, Г. и Бальзано, А.(2004). Тинидазол: от

простейших до Helicobacter pylori — прошлое, настоящее и

будущего нитроимидазола с особенностями. Эксперт

Обзор противоинфекционной терапии, 2, 695–705.

Мендоса, Д., Нунэз, Ф. А., Эскобедо, А. А., Пелайо,

Л., Фернандес, М., Торрес, Д. и Кордови, Р. А.

(2003). Utilidad de 2 me´todos coproparasitolo´gicos

y su empleo en un ensayo terape´utico antigiardiasico.

Revista Cubana de Medicina Tropical, 55, 174–178.

Нэш Т. Э., Ол К. А., Томас Э., Субраманиан Г.,

Кейзер П. и Мур Т. А. (2001). Лечение

больных рефрактерным лямблиозом. Клинические инфекционные

Болезни, 33, 22–28.

Нигам П., Капур К. К., Кумар А., Саркари Н. Б. и

Гупта А. К. (1991). Клинический профиль лямблиоза и

сравнение его терапевтического ответа на метрони-

дазол и тинидазол. Журнал ассоциации

врачей Индии, 39, 613–615.

Ортис, Дж. Дж., Аюб, А. и Гаргала, Н. Л., Чегне, Н. Л.

и Фавеннек, Л. (2001). Рандомизированное клиническое исследование

нитазоксанида по сравнению с метронидазолом в лечении симптоматического лямблиоза у детей

из

на севере Перу. Пищевая фармакология и

Терапия, 15, 1409–1415.

Pengsaa, K., Sirivichayakul, C., Pojjaroen-anat, C.,

Nimnual, S. & Wisetsing, P. (1999). Альбендазол

Лечение инфекций Giardia Кишечник в школе

детей.Журнал тропической медицины Юго-Восточной Азии

и общественное здравоохранение, 30, 78–83.

Ponce-Macotela, M., Go´mez-Gargun˜ o, J., Gonza´lez-

Maciel, A., Reynoso-Robles, R., Anislado-Tolentino,

V. & Martinez-Gordillo , MN (2001).

Определение in vitro восприимчивости к

нитазоксанида, содержащегося в Giardia duodenalis

obtenidos en diferentes hue´spedes. Revista de

Investigaciones Clı´nicas, 53, 41–45.

Рэтер, В. и Хэнель, Х. (2003). Нитрогетероциклические

препараты широкого спектра действия. Паразитология

Research, 90 (Suppl. 1), s19 – s39.

Родригес-Гарсия, Р., Родригес-Гузман, Л. М. и

Крус-дель-Кастильо, А. Х. (1999). Eficacia y seguridad

de mebendazol contra nitazoxanida en el tratamiento

de Giardia lamblia en nin˜ os. Revista de

Gastroenterologı´a Mexicana

, 64, 122–126.

Ромеро Кабелло, Р., Герреро, Л. Р., Мун оз Гарсиа,

М. Р. и Гейне Круз, А. (1997). Нитазоксанид для

лечения кишечных простейших и глистных

инфекций в Мексике. Труды Королевского общества

Тропическая медицина и гигиена, 91, 701–703.

Россиньол, Дж. Ф., Аюб, А. и Айерс, М. С. (2001).

Лечение диареи, вызванной Giardia Кишечник

и Entamoeba histolytica или Entamoeba dispar:

рандомизированное двойное слепое плацебо-контролируемое исследование

метронидазола.Журнал инфекционных болезней, 184,

381–384.

Россиньол, Дж. Ф., Абу-Зекри, М., Хусейн, А. и

Санторо, М. Г. (2006a). Эффект нитазоксанида для лечения

тяжелой ротавирусной диареи: рандомизированное

двойное слепое плацебо-контролируемое исследование. Ланцет, 368,

124–129.

Россиньол, Дж. Ф., Кабил С. М., Эль-Гохари Ю. и Юнис,

А. М. (2006b). Эффект нитазоксанида при диарее

и энтерите, вызванном видами Cryptosporidium.

Клиническая гастроэнтерология и гепатология, 4, 320–324.

206 ESCOBEDO ET AL.

Границы | Рециркуляция комплекса A Giardia lamblia после лечения метронидазолом в области со скоплениями A, B и E Симпатрическое кровообращение

Введение

Giardia lamblia — жгутиковые простейшие, поражающие тонкую кишку широкого спектра млекопитающих-хозяев. Он передается фекально-оральным путем, что тесно связано с плохими санитарными условиями.По оценкам последних исследований, более 183 миллионов человек в мире инфицированы Giardia (Torgerson et al., 2015).

Филогенетически G. lamblia разделен на восемь ассоциаций, обозначенных в алфавитном порядке от A до H. Люди в основном заражены комплексами A и B (Adam, 2001; Feng, Xiao, 2011; Cacciò et al., 2018). Присутствие комплекса E также было обнаружено, хотя и с гораздо меньшей частотой, чем A и B (Fantinatti et al., 2016; Scalia et al., 2016; Захеди и др., 2017). Специфические характеристики каждой из различных групп увеличивают возможности для уникальных факторов, связанных с вирулентностью, патогенезом и восприимчивостью к лекарствам. Однако, поскольку инфекция часто протекает бессимптомно, диагностика и лечение инфицированных людей могут быть затруднены.

В Бразилии основным классом препаратов, рекомендуемых для лечения лямблиоза, является 5-нитроимидазол. Несмотря на свою эффективность, препараты 5-нитроимидазола обладают рядом побочных эффектов (Gardner and Hill, 2001).Наиболее часто используемым препаратом является метронидазол из-за его низкой стоимости и легкого доступа. Хотя лечение метронидазолом, по-видимому, эффективно при большинстве инфекций, появляются новые доказательства увеличения частоты терапевтических неудач (Tejman-Yarden and Eckmann, 2011; Leitsch, 2015). В Лондоне, Соединенное Королевство, сообщалось о чрезмерном росте стойкой паразитарной инфекции после лечения 5-нитроимидазолом за период с 2008 по 2013 год, когда терапевтическая неудача увеличилась с 15.От 1 до 40,2% (Nabarro et al., 2015). Это очевидное увеличение можно объяснить рядом причин, таких как неадекватные дозировки, неполные схемы лечения, иммуносупрессия или лекарственная устойчивость (Lemée et al., 2000; Gardner and Hill, 2001; Nash et al., 2001; Escobedo et al., 2014).

В Бразилии инфекция Giardia распространена по стране, и расчетная точечная распространенность может достигать более 50% в районах социальной и санитарной уязвимости (Coelho et al., 2017). Это указывает на высокую скорость передачи паразита.С другой стороны, на сегодняшний день возникновение стойкой инфекции неизвестно. Мы предполагаем, что биологические характеристики каждого из циркулирующих сообществ могут влиять на обнаруженную ими заболеваемость и чувствительность к лекарствам. Настоящее исследование было предпринято для изучения циркуляции скоплений G. lamblia в районе с высокой распространенностью инфекции после лечения паразитированных индивидуумов метронидазолом.

Материалы и методы

Сбор образцов, диагностика и лечение паразитов

Исследование проводилось в детском саду, расположенном в экономически неблагополучном районе Рио-де-Жанейро, Бразилия.Всего в этом детском саду было обследовано 194 ребенка в возрасте от 10 месяцев до 4 лет в течение 2 лет. Ребенок был включен в исследование только после того, как родитель принял приглашение к участию, подписал Условия бесплатного и осознанного согласия, которые были одобрены этическим наблюдательным советом учреждения (номер CAAE: 19705613.9.0000.5248) и включали полное раскрытие преимуществ и рисков. . Для диагностики геогельминтов и простейших у каждого пациента брали один исходный образец стула.Образцы были отправлены на паразитологическое исследование кала по методикам Ричи и Като-катца. Кроме того, была проведена молекулярная диагностика с помощью ПЦР для выявления присутствия ДНК Giardia (см. Ниже).

Лица с положительным диагнозом патогенных паразитов лечились в соответствии с рекомендациями министерства здравоохранения Бразилии. При инфекциях Giardia пациентам давали метронидазол 15 мг / кг / день перорально (максимум 250 мг) в течение 5 или 7 дней в случае неэффективности лечения.Примерно через 20–35 дней после лечения был собран новый образец для определения контроля излечения. Лица, которые остались положительными, были подвергнуты второму циклу лечения метронидазолом, а затем повторно обследованы через 20 дней (второй контрольный курс лечения). Методология диагностики образцов вылеченного контроля была такой же, как и при первом обследовании.

Экстракция ДНК и молекулярная характеристика

G. lamblia

Образцы хранили при -20 ° C до молекулярной диагностики и определения характеристик.Экстракцию ДНК из цист проводили непосредственно из стула с использованием мини-набора QIAamp DNA Stool (Qiagen, Германия), в основном в соответствии с инструкциями производителя. Двумя исключениями были температура лизиса, которая была увеличена до 95 ° C, и объем буфера AE, используемый для элюции ДНК, который был уменьшен до 100 мкл. Выделенную ДНК хранили при -20 ° C до момента использования.

Для генотипирования G. lamblia использовали области консервативных генов, кодирующих глутаматдегидрогеназу ( gdh ) и бета-гиардин (β -gia ).Экстрагированную ДНК подвергали ПЦР и вложенной ПЦР (вторичная ПЦР) в конечном объеме 50 мкл реакции, содержащем 1X буфер для ПЦР, 3 мМ MgCl 2 , 2,5 ЕД ДНК-полимеразы Taq (Invitrogen Life Technologies, Бразилия). 200 мкМ трифосфатдезоксирибонуклеотидов dNTP (Invitrogen Life Technologies, Бразилия) и 0,2 мкМ каждого праймера.

Для амплификации мишени gdh в первичной ПЦР были использованы праймеры: GDH 1 (TTCCGTRTYCAGTACAACTC) и GDH 2 (ACCTCGTTCTGRGTGGCGCA), а во вторичной ПЦР: GDh4 (ATGACYGAGCTYCAGGGGCACG) в соответствии с GTCGCGCI и др., 2008. Для амплификации мишени β -gia в первичной ПЦР использовались праймеры: G7 (AAGCCCGACGACCTCACCCGCAGTGC) и G759 (GAGGCCGCCCTGGATCTTCGAGACGAC) и во вторичной ПЦР: B-GIAF (GAACGAACGACGATCGAG) (CCTGTCGACGACGARCGAG) в соответствии с к Cacciò et al., 2002 и Lalle et al., 2005, соответственно.

В качестве положительного контроля использовали экстракты ДНК из аксенических культур клона C6 штамма WB G. lamblia (ATCC 50803). Отрицательные контроли включали ДНК, экстрагированную из аксенических культур Entameba histolytica и Trichomonas vaginalis .Успешность амплификации подтверждали электрофорезом в агарозном геле при концентрации 1%.

продуктов ПЦР для каждой пары праймеров очищали с использованием набора NucleoSpin Gel и PCR Clean-up (Macherey-Nagel, Германия) в соответствии с инструкциями производителя, за исключением времени инкубации в буфере NE, которое увеличили до 5 мин. Очищенные продукты подвергали секвенированию в обоих направлениях в трех экземплярах с использованием набора для циклического секвенирования BigDye Terminator v3.1 (Applied Biosystems, Foster City, США).После осаждения реакции образцы анализировали в службе секвенирования платформы ДНК-секвенирования FIOCRUZ (Otto et al., 2007). Каждый эксперимент проводился в трех экземплярах.

Полученные электрофореграммы были проанализированы на качество в программе Chromas 2.4. Характеристику последовательностей проводили с использованием инструмента поиска базового локального выравнивания с использованием нуклеотидов (BLASTn), и консенсус был получен с помощью программы сборки последовательностей CAP3. Нуклеотидные последовательности gdh и β -gia из G.lamblia выравнивали по алгоритму CLUSTAL W (Thompson et al., 1994) в пакете Molecular Evolutionary Genetics Analysis (MEGA) 7.0 (Kumar et al., 2016).

Филогенетический анализ был выполнен с использованием программы MEGA 7.0, и использованная оценка расстояния была основана на уравнении Джина и Ней (1990) с использованием 2-параметров модели Кимуры). Последовательности новых изолятов в клинических образцах были выровнены с использованием последовательностей GenBank G. lamblia , принадлежащих ассоциациям A, B и E.В качестве внешних групп использовали последовательности из G. psittaci , G. muris и T. vaginalis . Соответствующие регистрационные номера последовательностей находятся между вертикальными чертами на филогенетических деревьях. Кроме того, последовательности фрагментов гена gdh и β -gia были объединены, и сообщалось о загрузке выше 60%.

Филогенетических деревьев были построены с использованием алгоритма объединения соседей (Saitou and Nei, 1987). Наилучшая статистическая модель была определена на основе самого низкого значения BIC, обнаруженного в MEGA (Kumar et al., 2016), где для обоих генов был выбран 2-параметр Кимуры. Для каждой конструкции достоверность каждой ветви определялась доверительным интервалом с помощью бутстрэп-анализа (1000 повторений) (Felsenstein, 1985). Характеристика последовательности G. lamblia , полученная из GenBank и использованная в качестве эталона для построения филогенетического дерева генов gdh и β -gia , представлена ​​в дополнительной таблице 2.

Программа обнаружения рекомбинации версии 4 (RDP4) использовалась для проверки событий рекомбинации в наших изолятах из клинических образцов, используя выравнивание конкатенированных последовательностей для генов gdh и β -gia (Martin et al., 2015). Наличие уникальной рекомбинации событий было подтверждено несколькими методами (RDP, GENECONV, BootScan, MaxiChi, Chimera, SiScan и 3Seq).

Оценка последовательности нуклеотидов в

G. lamblia Трофозоиты, непрерывно подвергающиеся действию метронидазола in vitro

Giardia lamblia трофозоитов из клона W6, штамм WB [ATCC50803], культивировали при 37 ° C в среде TYI-S-33 при pH 7,0 с добавлением 10% инактивированной фетальной бычьей сыворотки (Cultilab, Campinas, Brazil).Трофозоиты постоянно подвергались воздействию метронидазола (МТЗ) (Sigma Chemical Co., Сент-Луис, США) в течение минимум 16 недель. Экспериментальные группы определялись по концентрации воздействия МТЗ: группа 1 (МТЗ5) — 5 мкМ; группа (MTZ10) 2, 10 мкМ; группа 3 (MTZ20), 20 мкМ; группа 4 (СМТЗ) — без метронидазола; и группа 5 (CDMSO), подвергшаяся воздействию 0,05% диметилсульфоксида (Sigma, США), носителя для разведения MTZ. Концентрация, необходимая для подавления 50% роста паразитов (IC 50 ), была определена с использованием методологии, описанной Bénéré et al., 2007. Анализы для каждой экспериментальной группы были выполнены в трех экземплярах, и результаты IC 50 были определены с использованием программного обеспечения Prism 6.0 (GraphPad;). Для статистического анализа использовался тест ANOVA.

В конечный момент времени ДНК трофозоита G. lamblia экстрагировали с использованием ДНКзола (1 мл / 10 7 паразитов; Invitrogen, Карлсбад, Калифорния, США). Последовательности gdh и β -gia были получены и проанализированы, как описано выше.

Результаты

Частота

Г.lamblia Инфекция и определение устойчивости паразитов после лечения

Всего было взято 194 образца стула у детей, 109 женщин и 85 мужчин. При первом обследовании были обнаружены следующие паразиты: Ascaris lumbricoides (15/194 — 7,73%), Entameba histolytica / dispar (4/194 — 2,06%), Entameba coli (5/194 — 2,58%). ), Endolimax nana (13/194 — 6,70%) и G. lamblia (86/194 — 44,33%) (дополнительная таблица 1).Все пациенты с положительным результатом на G. lamblia получали метронидазол, и после лечения 36 оставались в исследуемой группе для оценки. В девятнадцати случаях после лечения они были представлены как хроническая инфекция и прошли второй курс лечения метронидазолом. При определении второго контрольного излечения 18 человек были повторно оценены. Из них у пятнадцати по-прежнему был поставлен положительный диагноз для G. lamblia (рис. 1). Эти случаи были индивидуально отслежены для других клинических подходов.

Рис. 1. Схематическое изображение положительности для Giardia lamblia в образцах фекалий детей в разные периоды исследования. Количество образцов, полученных в течение трех оценочных моментов исследования ( Giardia, ПЦР-выбор, 1-й контроль лечения и 2-й контроль лечения). Gia–: образцы с отрицательным диагнозом на Giardia по результатам ПЦР; Gia +: образцы с положительным диагнозом на Giardia с помощью ПЦР.

Генотипирование

G.lamblia Циркуляция у детей дошкольного возраста до и после лечения

ДНК G. lamblia , выделенная от 86 детей, положительных при первоначальном диагнозе, была генотипирована с использованием как gdh , так и β- gia в качестве мишеней. Мы наблюдали большую генетическую изменчивость изолятов из образцов. На основе согласованных последовательностей образцы были сгруппированы следующим образом: 40 изолятов в сборке A, 21 изолят в сборке B, 17 изолятов в сборке E и 4 изолята, показывающих характеристики как сборки A, так и E (Рисунки 2, 3).Многие различия наблюдались в подгруппах, характеризующих AI и AII.

Рис. 3. Филогенетическое дерево изолятов Giardia lamblia , собранных у детей до и после лечения с помощью алгоритма объединения соседей с использованием двухпараметрического метода Кимуры. (A) Филогенетическое дерево, основанное на последовательностях гена глутаматдегидрогеназы . (B) Филогенетическое дерево, основанное на последовательностях гена бета-гиардина .Последовательности имен обозначаются их инвентарными номерами. Красный ромб: CC1: выделение из образца первого контроля отверждения и CC2: выделение из образца второго контроля отверждения.

После первого контрольного исследования излечения 36 диагностированных случаев все еще были положительными на инфекцию Giardia и были повторно оценены. Исходя из первоначального определения группы сборки, 19 изолятов были из ассоциации A, 5 изолятов из ассоциации B, 9 изолятов из ассоциации E и 3 изолята из ассоциации A / E.После второго курса лечения 13 из 19 детей из группы A, 2 из 5 из группы B, 2 из 9 детей из группы E и 2 из 3 детей из группы A / E оставались положительными. Генотипирование показало, что 18 из них были сгруппированы как сборка A (таблица 1 и рисунок 3 и дополнительный рисунок 1). Любопытно, что комплексы B или E не были обнаружены среди положительных людей (рисунок 2 и дополнительный рисунок 1).

Таблица 1. Giardia lamblia скоплений, обнаруженных при первом диагнозе и после лечения.

Среди индивидуумов, инфицированных группой A (11 субъектов) при первой оценке и при первом контроле лечения, 9 изолятов продемонстрировали 100% идентичность между изолятами из образцов до и после лечения для двух использованных генных мишеней ( gdh и β -gia ). Три человека продемонстрировали генотипическое расхождение между изолятами из первой проанализированной оценки и первого контрольного лечения. Два показали различия в гене β -gia , а другие показали различия в мишени gdh .

После 2-го курса лечения 15 случаев продолжали оставаться положительными, при этом 13 изолятов были сгруппированы в комплекс А, что включало идентификацию уникального комплекса. Все последовательности из второго контроля лечения показали 100% идентичность с последовательностью того же человека в первом контроле лечения.

Три образца, которые были положительными после лечения, один из 1-й контрольной группы и два из 2-й контрольной группы, были амплифицированы, но не охарактеризованы.Три других изолята были генотипированы только на основе гена gdh .

Среди людей, которые представили изоляты, сгруппированные как совокупность А в первом исследовании и в последовательных контрольных исследованиях, 8 случаев показали 100% идентичность изолятов во все три момента анализа.

При использовании RDP4 количество возможных уникальных рекомбинаций событий среди конкатенированных последовательностей было различным в зависимости от метода обнаружения (RDP: 13, GENECONV: 15, BootScan: 9, MaxiChi: 9, Chimera: 11, SiScan: 20, 3Seq: 19) .В области гена β -gia было обнаружено несколько событий рекомбинации (RDP: 0, GENECONV: 1, BootScan: 0, MaxiChi: 1, Chimera: 1, SiScan: 1, 3Seq: 2). Наибольшее количество рекомбинации наблюдалось в области гена gdh (RDP: 13, GENECONV: 9, BootScan: 6, MaxiChi: 6, Chimera: 6, SiScan: 9, 3Seq: 13). Оба изолята ассоциации B и E представили одно событие рекомбинации. Демонстрация одного и того же филогенетического профиля среди изолятов из каждого кластера сообщества. Все остальные события рекомбинации наблюдались в сборке A для мишени gdh.

Отсутствие изменений в нуклеотидных последовательностях

gdh и β -gia из G. lamblia Трофозоиты не наблюдались после воздействия in vitro метронидазола

Значения IC 50 групп MTZ5, MTZ10 и MTZ20 были значительно выше, чем значения, представленные контрольными группами SMTZ и CDMSO. Никаких различий в нуклеотидных последовательностях между группами не наблюдалось (представлено Lopes-Oliveira et al.). Эти результаты продемонстрировали, что, несмотря на серьезное вмешательство в выживаемость паразита, MTZ не вызывает изменений в оцениваемых консервативных генах.

Обсуждение

Передача G. lamblia более распространена в районах без элементарной санитарии (водоочистные и канализационные сети), что является реальностью в районах Бразилии с низкими доходами. Внутривидовые и межвидовые контакты могут способствовать распространению лямблиоза (Feng and Xiao, 2011), что является реальностью в регионах с низким уровнем доходов, где кошки и собаки могут свободно передвигаться, а также может находиться домашний скот. Эти множественные источники могут увеличить риск заражения, а также повторного заражения на G.lamblia и может объяснить высокую распространенность инфекции, наблюдаемую в настоящем исследовании. Однако неизвестно, связан ли профиль сборки Giardia с бременем инфекции.

Здесь были идентифицированы три комплекса G. lamblia (A, B и E), обнаруженные у людей. В нашем исследовании наблюдалась высокая скорость конвергенции между генными мишенями ( gdh и β -gia ), используемыми для генотипирования. Поскольку гены, используемые для генотипирования, считаются консервативными, ожидается хороший дискриминационный потенциал среди совокупностей (Ryan and Cacciò, 2013).Однако низкая нуклеотидная изменчивость, наблюдаемая среди подгрупп A, ставит под сомнение эффективность этих генов-мишеней для характеристики изолятов AI и AII, главным образом (Lebbad et al., 2010, 2011; Ankarklev et al., 2018). Немногочисленные нуклеотидные изменения могут быть недостаточными или достаточными для дифференцировки на субсборки. Используя метод обнаружения для идентификации возможных уникальных событий рекомбинации, ген β -gia оказался более консервативным, чем ген gdh . Высокая скорость рекомбинации, наблюдаемая в группе А гена gdh , указывает на высокую вариабельность среди изолятов этой группы в данном исследовании.Это оправдывает расхождение характеристик между подгруппами AI и AII в генах-мишенях. События рекомбинации между субкомплексами AI и AII и между ассоциациями A и E могут происходить (Xu et al., 2012; Ankarklev et al., 2018). Мы обнаружили четыре случая несогласия между ассоциациями A и E, но в этом исследовании не наблюдалось событий рекомбинации. Об этом несогласии между сообществами часто сообщают (Cacciò et al., 2008).

Встречаемость ассоциации A была выше по сравнению с B или E.Немногочисленные отчеты, посвященные скоплениям Giardia в Бразилии, указывают на региональные различия в распространенности преобладающего циркулирующего сообщества (Coelho et al., 2017). В Рио-де-Жанейро комплекс A чаще всего идентифицируется у людей (Volotão et al., 2007; Fantinatti et al., 2016), хотя комплекс B (Faria et al., 2016) и комплекс E (Fantinatti et al. , 2016) уже сообщалось. Настоящие результаты согласуются и подтверждают опубликованный эпидемиологический профиль скоплений Giardia в нашем регионе.

В нашем предыдущем исследовании, проведенном в этом регионе, был идентифицирован комплекс E и особенно комплекс A (Fantinatti et al., 2016). Результаты здесь показывают, что циркуляция этих сообществ все еще существует, а группа A усиливается по всей окружающей среде домашними животными (Volotão et al., 2007; Fantinatti et al., 2018). Однако идентификация ассоциации B, циркулирующей у инфицированных детей, не была подтверждена, хотя в тот же период было сообщено о первой идентификации ассоциации B в Рио-де-Жанейро (Faria et al., 2016). Дальнейшие исследования образцов окружающей среды могут помочь понять преобладание сообщества A.

В Бразилии лекарство, наиболее часто используемое службой общественного здравоохранения для лечения лямблиоза, — это метронидазол, и в большинстве случаев лечение оказывается эффективным. Однако реальная частота терапевтических неудач метронидазола в Бразилии до сих пор неизвестна. Наблюдаемый нами уровень продолжающейся инфекции после лечения метронидазолом считался высоким, поскольку 19 из 36 детей, прошедших повторную оценку, были инфицированы при первом контрольном излечении.Это продолжалось после второго контрольного лечения, когда 15 из 18 были положительными. Положительные случаи в контрольной группе излечения могут быть результатом терапевтической неудачи (субдоза препарата, устойчивость к паразитам) или повторного инфицирования (Argüello-García et al., 2004).

Отрицательные результаты лечения метронидазолом, скорее всего, являются терапевтическим успехом. Это событие наблюдалось у людей, инфицированных тремя разными сообществами. Было высказано предположение, что определенная совокупность может быть связана с длительным лямблиозом и случаями персистирования инфекции после лечения (Mørch et al., 2008). Ни один из изолятов из контрольных образцов лечения не был генотипирован как совокупность B или E. Это может свидетельствовать о том, что лечение было эффективным для устранения этих совокупностей. Однако нельзя утверждать, что эти ассоциации (B и E) более чувствительны к действию MTZ, чем группа A. Поскольку клонирование гена не проводилось в этом исследовании, невозможно исключить коинфекцию, и была обнаружена только одна совокупность. с помощью реакций секвенирования SANGER.

Поскольку в исследуемой общине плохие жилищные условия и плохие базовые санитарные условия, основная гипотеза состоит в том, что случаи стойких инфекций являются результатом последовательных инфекций.Это подтверждается теми случаями, когда совокупность, идентифицированная после цикла лечения, отличалась от первой оценки. Сборка А была единственной сборкой, идентифицированной при 1-м и 2-м контроле отверждения. Учитывая высокую частоту ассоциации A в районе наших исследований, наиболее вероятно, что повторное заражение будет происходить от этой группы. За исключением трех образцов, 100% идентичность наблюдалась между последовательностями, оцененными до и после у одного и того же человека. Хотя повторное заражение той же самой группой не может исключить за короткий период, в нашей области исследования в событиях повторного заражения ожидалось около половины детей, инфицированных совокупностями B или E в контрольном излечении (согласно первому обследованию).Это говорит о том, что следует учитывать терапевтическую неудачу и сопротивление.

Как упоминалось выше, три человека, которые сохраняли положительную реакцию на группу А после цикла лечения, показали генотипическое расхождение между первым проанализированным образцом и первым излеченным контролем. Нуклеотидные изменения, вероятно, не были следствием лечения, поскольку эти мишени не были изменены, когда трофозоитов Giardia были in vitro, подвергались воздействию различных концентраций MTZ.Это предполагает, что эти люди были инфицированы другим штаммом того же сообщества, но с другим подтипом.

Результаты, полученные в нашей области исследования, позволяют предположить, что дети в течение длительного периода времени остаются инфицированными G. lamblia . Частые эпизоды повторного заражения и персистенции паразитов были замечательными открытиями в нашей области исследования. В регионах с высокой частотой инфицирования и повторного заражения также ожидается частое применение метронидазола. Однако пока невозможно определить, были ли рецидивирующие случаи связаны с лекарственной устойчивостью паразитов.Длительная паразитарная инфекция Giardia может вызвать снижение уровня жирорастворимых витаминов и стеаторею, а также задержку роста. Воздействие лямблиоза на развитие ребенка усиливает серьезность этого типа инфекции как проблемы общественного здравоохранения, которая, хотя в основном незаметна и не привлекает внимания общественности, требует более пристального внимания. Настоящие результаты поднимают вопрос для регионов с высокой частотой инфицирования, может ли лечение лямблиоза подвергать детей дополнительным побочным эффектам от препарата, одновременно маскируя потребность в мерах борьбы с паразитами, которые требуют изменений в государственной политике для поощрения инвестиций в улучшение санитарные условия.

Заявление о доступности данных

Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория / репозиториев и номера доступа можно найти в статье / Дополнительных материалах.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Comitê de Ética em Pesquisa do Instituto Oswaldo Cruz (CEP FIOCRUZ / IOC). Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном / ближайшими родственниками участников.

Авторские взносы

MF: концептуализация, методология, привлечение финансирования и написание рукописи. LL-O: методология. TC-F: методология. ПА-Т: методология. ЭВ: методология. АБ: формальный анализ. AD-C: концептуализация, привлечение финансирования и написание рукописи. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была поддержана внутренним финансированием Института Освальдо Круза (PAEF II-IOC-23-FIO-18-2-53), CNPq (Universal — 435015 / 2018-4).MF получил финансирование от Universal / CNPq (435015 / 2018-4). MF получил стипендию от CAPES (Brasil Sem Miséria / Бразильская правительственная программа) и CNPq (PDJ). AD-C имеет исследовательскую стипендию от CNPq и FAPERJ (CNE).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы глубоко признательны Элизабет Сальгадо и команде яслей за их безоговорочную поддержку набора детей, а также команде Clinica da Familia из CMS Heitor Beltrão-SMS-RJ за клиническую помощь.Мы признательны доктору В. Провансу за его ценный критический обзор и английское издание. Мы хотим поблагодарить платформу для секвенирования ДНК — Fundação Oswaldo Cruz. Наконец, мы признательны доктору Октавио Фернандесу за то, что он предоставил нам основу для этого направления исследований.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.571104/full#supplementary-material

Сноски

Список литературы

Адам, Р.Д. (2001). Биология Giardia lamblia . Clin. Microbiol. Ред. . 14, 447–475.

Google Scholar

Анкарклев, Дж., Леббад, М., Эйнарссон, Э., Францен, О., Ахола, Х., Троелл, К. и др. (2018). Новое мультилокусное типирование с высоким разрешением последовательности изолятов Giardia Кишечник группы А выявляет зоонозную передачу, клональные вспышки и рекомбинацию. Заражение. Genet. Evol. 60, 7–16. DOI: 10.1016 / j.meegid.2018.02.012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Аргуэльо-Гарсия, Р., Крус-Сото, М., Ромеро-Монтойя, Л., и Ортега-Пьер, Г. (2004). Вариабельность и вариабельность лекарственной чувствительности изолятов и клонов Giardia duodenalis , подвергшихся воздействию 5-нитроимидазолов и бензимидазолов in vitro . J. Antimicrob. Chemother. 54, 711–721. DOI: 10.1093 / jac / dkh488

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бенере, Э., да Луз, Р. А., Вермеерш, М., Кос, П., и Маес, Л. (2007). Новый количественный метод микрокультивирования in vitro для трофозоитов Giardia duodenalis . J. Microbiol. Методы 71, 101–106. DOI: 10.1016 / j.mimet.2007.07.014

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Каччио С.М., Бек Р., Лалле М., Маринкулик А. и Позио Э. (2008). Мультилокусное генотипирование Giardia duodenalis выявило поразительные различия между комплексами A и B. Int. J. Parasitol. 38, 1523–1531. DOI: 10.1016 / j.ijpara.2008.04.008

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Каччио, S.М., Де Джакомо, М., и Позио, Э. (2002). Анализ последовательности гена бета-гиардина и разработка анализа полиморфизма длины рестрикционного фрагмента полимеразной цепной реакции для цист генотипа Giardia duodenalis из образцов фекалий человека. Внутр. J. Parasitol. 32, 1023–1030. DOI: 10.1016 / s0020-7519 (02) 00068-1

CrossRef Полный текст | Google Scholar

Каччи, С. М., Лалле, М., Свярд, С. Г. (2018). Специфичность хозяина в комплексе видов Giardia duodenalis . Заражение. Genet. Evol. 66, 335–345. DOI: 10.1016 / j.meegid.2017.12.001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Коэльо, К. Х., Дуриган, М., Лил, Д. А. Г., Шнайдер, А. Б., Франко, Р. М. Б. и Сингер, С. М. (2017). Лямблиоз как забытое заболевание в Бразилии: систематический обзор публикаций за 20 лет. PLoS Negl. Троп. Дис. 11: e0006005. DOI: 10.1371 / journal.pntd.0006005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эскобедо, А.А., Ханевик, К., Альмиралл, П., Цимерман, С., и Альфонсо, М. (2014). Ведение хронической инфекции Giardia . Expert Ver. Анти. Заразить. Ther. 12, 1143–1157. DOI: 10.1586 / 14787210.2014.942283

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фантинатти М., Белло А. Р., Фернандес О. и Да-Крус А. М. (2016). Идентификация комплекса E Giardia lamblia у человека указывает на новый антропозоонозный цикл. J. Infect.Дис. 214, 1256–1259. DOI: 10.1093 / infdis / jiw361

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фантинатти М., Казека А. К., Белло А. Р., Фернандес О. и Да-Крус А. М. (2018). Присутствие Giardia lamblia комплекса A у собак предполагает антропозоонозный цикл паразита в Рио-де-Жанейро, Бразилия. Заражение. Genet. Evol. 65, 265–269. DOI: 10.1016 / j.meegid.2018.07.025

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фариа, К.П., Занини, Г. М., Диаш, Г. С., да Силва, С., и Соуза, М. К. (2016). Молекулярная характеристика Giardia lamblia : первое сообщение об ассоциации B в человеческих изолятах из Рио-де-Жанейро (Бразилия). PLoS One 11: e0160762. DOI: 10.1371 / journal.pone.0160762

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Felsenstein, J. (1985). Пределы уверенности в филогении: подход, использующий бутстрап. Evolution. 39, 783–791. DOI: 10.2307/2408678

CrossRef Полный текст | Google Scholar

Гарднер Т. Б. и Хилл Д. Р. (2001). Лечение лямблиоза. Clin. Microbiol. Ред. 14, 114–128.

Google Scholar

Джин Л. и Ней М. (1990). Ограничения метода эволюционной экономии филогенетического анализа. Мол. Биол. Evol. 7, 82–102.

Google Scholar

Кумар, С., Стечер, Г., Тамура, К. (2016). MEGA7: анализ молекулярной эволюционной генетики, версия 7.0 для больших наборов данных. Мол. Биол. Evol. 33, 1870–1874. DOI: 10.1093 / molbev / msw054

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лалле М., Позио Э., Капелли Г., Бруски Ф., Кротти Д. и Каччио С. М. (2005). Генетическая гетерогенность по локусу бета-гиардина среди изолятов Giardia duodenalis человека и животных и идентификация потенциально зоонозных субгенотипов. Внутр. J. Parasitol. 35, 207–213. DOI: 10.1016 / j.ijpara.2004.10.022

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Lebbad, M., Mattsson, J. G., Christensson, B., Ljungström, B., Backhans, A., Andersson, J.O., et al. (2010). От мыши к лосю: мультилокусное генотипирование изолятов Giardia от различных видов животных. Вет. Паразитол. 168, 231–239. DOI: 10.1016 / j.vetpar.2009.11.003

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Леббад, М., Петерссон, И., Карлссон, Л., Botero-Kleiven, S., Andersson, J.O., Svenungsson, B., et al. (2011). Мультилокусное генотипирование изолятов Giardia человека предполагает ограниченную зоонозную передачу и связь между комплексом B и метеоризмом у детей. PLoS Negl. Троп. Дис. 5: e1262. DOI: 10.1371 / journal.pntd.0001262

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Леме В., Захария И., Невез Г., Рабодонирина М., Брассер П., Балет, Дж. Дж. И др. (2000). Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J. Antimicrob. Chemother. 46, 819–821. DOI: 10.1093 / jac / 46.5.819

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Мартин Д. П., Мюррелл Б., Голден М., Хосал А. и Мухир Б. (2015). RDP4: обнаружение и анализ паттернов рекомбинации в вирусных геномах. Virus Evol. 1: vev003.

Google Scholar

Мёрч К., Ханевик К., Робертсон Л. Дж., Стрэнд Э. А. и Лангеланд Н. (2008). Лечебная лестница и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. J. Infect. 56, 268–273. DOI: 10.1016 / j.jinf.2008.01.013

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Набарро Л. Э., Левер Р. А., Армстронг М. и Чиодини П. Л. (2015). Повышенная заболеваемость нитроимидазолрезистентным лямблиозом в больнице тропических болезней, Лондон, 2008–2013 гг. Clin. Microbiol. Заразить. 21, 791–796. DOI: 10.1016 / j.cmi.2015.04.019

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нэш, Т.Э., Ол, К. А., Томас, Э., Субраманиан, Г., Кейзер, П., и Мур, Т. А. (2001). Лечение пациентов с рефрактерным лямблиозом. Clin. Заразить. Дис. 33, 22–28. DOI: 10.1086 / 320886

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Отто Т. Д., Катанью М., Деграв В. и де Миранда А. Б. (2007). Платформа биоинформатики PDTIS: от последовательности к функции. Ред. Электрон. Сообщество. Инф. Инов. Saude 1, 286–294.

Google Scholar

Райан, У.и Каччио С. М. (2013). Зоонозный потенциал лямблий. Int. J. Parasitol. 43, 943–956.

Google Scholar

Saitou, N., and Nei, M. (1987). Метод объединения соседей: новый метод реконструкции филогенетических деревьев. Мол. Биол. Evol. 4, 406–425.

Google Scholar

Скалия, Л. А., Фава, Н. М., Соареш, Р. М., Лимонги, Дж. Э., да Кунья, М. Дж., Пена, И. Ф. и др. (2016). Мультилокусное генотипирование Giardia duodenalis у детей Бразилии. Пер. R. Soc. Троп. Med. Hyg. 110, 343–349.

Google Scholar

Томпсон, Дж. Д., Хиггинс, Д. Г., и Гибсон, Т. Дж. (1994). CLUSTAL W: повышение чувствительности последовательного прогрессивного совмещения множественных последовательностей за счет взвешивания последовательностей, штрафов за пропуски для конкретных позиций и выбора матрицы весов. Nucleic Acids Res. 22, 4673–4680. DOI: 10.1093 / nar / 22.22.4673

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Торгерсон, П.R., Devleesschauwer, B., Praet, N., Speybroeck, N., Willingham, A.L., Kasuga, F., et al. (2015). Оценки Всемирной организации здравоохранения глобального и регионального бремени болезней, вызванных 11 паразитарными болезнями пищевого происхождения, 2010 г .: обобщение данных. PLoS Med. 12: e1001920. DOI: 10.1371 / journal.pmed.1001920

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Волотао, А.С., Коста-Маседо, Л.М., Хаддад, Ф.С., Брандао, А., Перальта, Дж. М., и Фернандес, О. (2007). Генотипирование Giardia duodenalis из образцов человека и животных из Бразилии с использованием гена бета-гиардина: филогенетический анализ. Acta Trop. 102, 10–19. DOI: 10.1016 / j.actatropica.2007.02.010

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сюй Ф., Йерлстрём-Хультквист Дж. И Андерссон Дж. О. (2012). Полногеномный анализ рекомбинации позволяет предположить, что скоплений Giardia Кишечник и представляют разные виды. Мол. Биол. Evol. 29, 2895–2898. DOI: 10.1093 / molbev / mss107

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Захеди, А., Филд, Д., Райан, У. (2017). Молекулярное типирование Giardia duodenalis у людей в Квинсленде — первое сообщение об объединении E. Parasitology 144, 1154–1161. DOI: 10.1017 / s0031182017000439

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Индийская педиатрия — редакция

1. Диас Э., Монтаж Дж., Рамирес Э., Бернаи Р.
Эпидемиология и борьба с паразитами кишечника с
нитазоксанид у детей в Мексике.Am J Trop Med Hyg 2003; 68:
384-385.

2. Перечни лекарственных средств, утвержденные в 2002 году.
из URL http://www.centerwatch.com/patient/drugs/drugls02.htm#section5.

3. Списки лекарственных средств, утвержденных в течение
1994-2005. Доступно по адресу http://cdsco.nic.in/DRUGSAPRVD.htm.
по состоянию на 04.07.2005.

4. Кадильо Ривера Р., Чаваес Б.,
Гонсалес-Роблес А., Епез-мулиа. In vitro действие
нитазоксанид против Entamoeba histolytica, Giardia
кишечник
и Trichomonas vaginalis трофозоиты .
J Eukaryot M Microbiol 2002; 49: 201-208.

5. Уокер М., Россиньоль Дж. Ф., Торгерсон П.,
Hemphill A. In vitro влияние нитазоксанида на
Протосколесы и метацестоды Echinococcuus granulosus. J
Antimicrob Chemother 2004; 54: 609-616.

6. Guttner Y, Windsor HM, Viiala CH, Dusci L,
Mershall BJ. Нитазоксанид в лечении Helicobacter pylori :
Клинические исследования и исследования in vitro. Противомикробные агенты Chemother 2003;
47: 3780-3783.

7. Favennac L, Ortiz Jane J, Gargala G,
Чегне Лопес Н., Аюб А., Россиньол Дж. Ф. Двойной слепой, рандомизированный,
плацебо-контролируемое исследование нитазоксанида при лечении
Фасциолез у взрослых и детей из северного Перу.Алимент
Pharmacol Ther 2003; 17: 265-270.

8. Амади Б., Муния М., Мусуку Дж., Варука А.,
Sianongos S, Ayoub A, et al. Влияние нитазоксанида на
смертность и смертность среди детей Замбии с
Рандомизированное контролируемое исследование криптоспоридиоза. Lancet 2002; 360:
1375-1380.

9. Россиньол JF, Ayoub A, Ayers MS. Уход
диареи, вызванной Giardia Кишечник и Entamoeba
histolytica
или E.dispar: Рандомизированный, двойной слепой,
плацебо-контролируемое исследование нитазоксанида. J Infect Dis 2001;
184: 381-384.

10. Россиньол JF, Ayoub A, Ayers MS.
Лечение диареи, вызванной Cryptosporidium parvum : A
проспективное рандомизированное двойное слепое плацебо-контролируемое исследование
нитазоксанида. J Infect Dis 2001; 184: 103-106.

11. Rossignol JF, Maisonneenne H.Нитазоксанид в лечении Taenia Saginata и
Hymenolepis nana
инфекции. Am J Trop Med Hyg 1984; 33:
511-512.

12. Теодос К.М., Гриффитс Дж. К., Донфро Дж.,
Fairfield A, Tzipori S. Эффективность нитазоксанида против
Cryptosporidium parvum
в культуре клеток и животных моделях.
Antimicrob Agents Chemo-ther 1998; 42: 1959-1965.

13.Белкинд-Волдонинос Ю., Белкинд-Герсон Дж.,
Санчес-Франсия Д., Эспиноза-Руис MM, Ласкано-Панс Э.
Нитазоксанид против альбендазола против кишечных паразитов в
разовая доза и в течение трех дней. Salud Publica Mex 2004; 46:
333-340.

14. Давилья-Гутьеррес CE, Vasqez C,
Трухильо-Эрнандес Б, Хверта М. Нитазоксанид в сравнении с
хинфамид и мебендазол при лечении гельминтов
инфекции и кишечные простейшие у детей.Am J Trop Med
Hyg 2002; 66: 251-254.

15. Ортиз Дж.Дж., Аюб А, Гагла Г., Чегне Н.Л.,
Фавеннак Л. Рандомизированное клиническое исследование нитазоксанида по сравнению с
метронидазол в лечении симптоматической лямблиоза у
дети из северного Перу. Aliment Pharmacol Ther 2001; 15:
1409-1415.

16. Родригес-Гарсия Р., Родригес-Гусман Л.М.,
Cruz delcastilo AH.Эффективность и безопасность мебендазола
по сравнению с нитазоксанидом при лечении Giardia lamblia
у детей. Препарат Гастроэнтерол Мекс 1999; 64: 122-126.

17. Doumbo O, Rossignol JF, Pichard E, Traore
HA, Dembele TM, Diakite M, и др. Нитазоксанид в
лечение криптоспоридиальной диареи и других кишечных
паразитарные инфекции, связанные со СПИДом в тропической Африке.Являюсь
J Trop Med Hyg 1997; 56: 637-639.

18. Россиньол Дж. Ф., Идальго Х., Феррегрино М.,
Игера Ф., Гомес У.Х., RomeroJL, и др. . Двойной слепой
плацебо-контролируемое исследование нитазоксанида при лечении
Криптоспоридиальная диарея у больных СПИДом в Мексике. Trans R Soc
Trop Med Hyg 1998; 92: 663-666.

19. Mosbys Drug Consult. Нитазоксанид из
URL: http: // www.mosbydrugconsult.com/Drug consult / 003576.html.
Проверено 12. 12. 2004.

.

20. Megraud F, Occhialini A, Rossignol J F. Нитазоксанид, a
потенциальный препарат для ликвидации Helicobacter pylori
без перекрестной резистентности к метронидазолу. Противомикробные агенты
Chemother 1998; 42: 2836-2840.

Распространенность и факторы риска инфекции Giardia duodenalis среди детей: тематическое исследование в Португалии | Паразиты и переносчики

  • 1.

    Flanagan PA: Giardia — диагностика, клиника и эпидемиология. Обзор. Epidemiol Infect. 1992, 109: 1-22.

    PubMed Central
    CAS
    PubMed

    Google Scholar

  • 2.

    Bertrand I, Gantzer C, Chesnot T, Schwartzbrod J: Повышенная специфичность для количественного определения цист Giardia lamblia в сточных водах путем разработки метода ПЦР в реальном времени. J Microbiol Met. 2004, 57: 41-53.

    CAS
    Статья

    Google Scholar

  • 3.

    Йодер Дж., Бич М.: Эпиднадзор за лямблиозом — США, 2003–2005 гг. Surveill Summ. 2007, 56 (SS07): 11-18.

    Google Scholar

  • 4.

    Оберхубер G, Kastner N, Stolte M: Лямблиоз: гистологический анализ 567 случаев. Scand J Gastroenrol. 1997, 32 (1): 48-51. 10.3109 / 0036552970

    62.

    CAS
    Статья

    Google Scholar

  • 5.

    Адам РД: Биология Giardia lamblia .Clin Microbiol Rev.2001, 14 (3): 447-475. 10.1128 / CMR.14.3.447-475.2001.

    PubMed Central
    CAS
    Статья
    PubMed

    Google Scholar

  • 6.

    Нур ЭМИ, Сан Ю.М., Ган С.К., Юсри М.Ю., Нурулсиамзавати Ю., Зухайзам А.Х., Маславати М.Н., Норпартина I, Витилингам I. Распространенность кишечных простейших в сообществе аборигенов в Паханге, Малайзия. Троп Биомед. 2007, 24 (1): 55-62.

    Google Scholar

  • 7.

    Thompson RC: Зоонозное значение и молекулярная эпидемиология Giardia и лямблиоза. Vet Parasitol. 2004, 126: 15-35. 10.1016 / j.vetpar.2004.09.008.

    Артикул
    PubMed

    Google Scholar

  • 8.

    Доуруман А., Кустимур С., Озекинчи Т., Балабан Н., Ильхан М.: Использование методов иммуноферментного анализа (ELISA) и прямых флуоресцентных антител (DFA) для диагностики Giardia Кишечник .Türkiye Parazitoloji Derneği. 2006, 30 (4): 275-278.

    Google Scholar

  • 9.

    Тейшейра Дж., Хеллер Л., Баррето М: Инфекция Giardia duodenalis : факторы риска для детей, живущих в нестандартных поселениях в Бразилии. Cad Saúde Pública. 2007, 23 (6): 1489-1493.

    Артикул
    PubMed

    Google Scholar

  • 10.

    Верниль А., Наби А.К., Бонадонна Л., Брианческо Масса S: наличие Giardia и Cryptosporidium в системах водоснабжения Италии.Оценка состояния окружающей среды. 2009, 152: 203-207. 10.1007 / s10661-008-0308-4.

    CAS
    Статья
    PubMed

    Google Scholar

  • 11.

    Каччио С.М., Томпсон Р.К., Маклаухлин Дж., Смит Х.В.: раскрытие эпидемиологии криптоспоридиума и лямблий . Trends Parasitol. 2005, 21 (9): 430-437. 10.1016 / j.pt.2005.06.013.

    Артикул
    PubMed

    Google Scholar

  • 12.

    Якуб Дж, Джафри В., Абиб С., Джафри Н., Хамид С., Шах Х.А., Ризви Л., Ислам М., Шейх Х .: Лямблиоз у пациентов с диспепсическими симптомами. Мир Дж. Гастроэнтерол. 2005, 11 (2): 6667-6670.

    PubMed Central
    PubMed

    Google Scholar

  • 13.

    Аль-Саид А.Т., Исса Ш. Обнаружение антигена Giardia lamblia в образцах стула с использованием иммуноферментного анализа. East Mediterr Health J. 2010, 16 (4): 362-364.

    CAS
    PubMed

    Google Scholar

  • 14.

    Савиоли Л., Смит Х., Томпсон А: Giardia и Cryptosporidium присоединяются к «Инициативе по забытым болезням». Trends Parasitol. 2006, 22 (5): 203-208. 10.1016 / июл.2006.02.015.

    CAS
    Статья
    PubMed

    Google Scholar

  • 15.

    Schunk M, Jelinek T, Wetzel K, Nothdurft H: Обнаружение Giardia lamblia и Entamoeba histolytica в образцах стула с помощью двух иммуноферментных анализов.Eur J Clin Microbiol Infect Dis. 2001, 20 (6): 389-391.

    CAS
    Статья
    PubMed

    Google Scholar

  • 16.

    Перейра М., Атвилл Э., Барбоза А. Распространенность и связанные факторы риска инфекции Giardia lamblia среди детей, госпитализированных по поводу диареи в Гоянии, штат Гояс, Бразилия. Rev Inst Med Trop S Paulo. 2007, 49 (3): 139-145. 10.1590 / S0036-46652007000300002.

    Артикул
    PubMed

    Google Scholar

  • 17.

    Олеастро М., Пелерито А., Ногейра П., Бенолиэль Дж., Сантос А., Кабрал Дж., Лопес А.И., Рамальо П.М., Монтейро Л.: Распространенность и заболеваемость инфекцией Helicobacter pylori среди здорового педиатрического населения в районе Лиссабона. Helicobacter. 2011, 16 (5): 363-372. 10.1111 / j.1523-5378.2011.00858.x.

    Артикул
    PubMed

    Google Scholar

  • 18.

    Смит Х.В., Робертсон Л.Дж., Кэмпбелл А.Т., Гидвуд RWA: Лямблии и лямблиоз: что в названии ?.Microbiol Eur. 1995, 3 (1): 22-29.

    Google Scholar

  • 19.

    Thompson RCA, Reynoldson JA: Giardia and Giardiasis. Adv Parasitol. 1993, 32: 71-160.

    CAS
    Статья
    PubMed

    Google Scholar

  • 20.

    Xiao L: Лямблии Инфекция сельскохозяйственных животных. Паразитол сегодня. 1994, 10 (11): 436-438. 10.1016 / 0169-4758 (94)

    -3.

    CAS
    Статья
    PubMed

    Google Scholar

  • 21.

    Schunk M, Jelinek T, Wetzel K, Nothdurft HD: обнаружение Giardia lamblia и Entamoeba histolytica в образцах стула с помощью двух иммуноферментных анализов. Eur J Clin Microbiol Infect Dis. 2001, 20: 389-391.

    CAS
    Статья
    PubMed

    Google Scholar

  • 22.

    Апкрофт П: Отчет о встрече: Анаэробные простейшие паразиты, Прага, Чешская Республика, 15-19 июля 2001 г. Protist. 2001, 152 (4): 241-242. 10.1078 / 1434-4610-00000.

    CAS
    Статья
    PubMed

    Google Scholar

  • 23.

    Рейнталер Ф., Фейерл Г., Штюнцнер Д., Март Э.: Диарея у возвращающихся австрийских туристов: эпидемиология, этиология и анализ затрат. J Travel Med. 1998, 5: 65-72. 10.1111 / j.1708-8305.1998.tb00466.x.

    CAS
    Статья
    PubMed

    Google Scholar

  • 24.

    Guidetti C, Ricci L, Vecchi L: Prevalenza delle parassitosi Кишечник в Реджо-Эмилии и Провинции на корсо-дель-2009.Infez Med. 2010, 3: 154-161.

    Google Scholar

  • 25.

    Дэвис А.П., Кэмпбелл Б., Эванс М.Р., Боун А., Рош А., Чалмерс Р.М.: Бессимптомное носительство простейших паразитов у детей в детских садах в Соединенном Королевстве. Pediatr Infect Dis J. 2009, 28 (9): 838-840. 10.1097 / INF.0b013e31819d646d.

    Артикул
    PubMed

    Google Scholar

  • 26.

    Sagebiel D, Weitzel T, Stark K, Leitmeyer K: Лямблиоз в детских садах: исследование распространенности в Берлине, Германия, 2006.Parasitol Res. 2009, 105 (3): 681-687. 10.1007 / s00436-009-1438-5.

    CAS
    Статья
    PubMed

    Google Scholar

  • 27.

    Крамарь Л.В., Резников Е.В., Крамарь О.Г. Распространенность лямблиоза среди населения г. Волгограда. Мед Паразитол (Моск). 2003, 4: 38-39.

    Google Scholar

  • 28.

    Almeida AA, Delgado ML, Soares SC, Castro AO, Moreira MJ, Mendonça CM, Canada NB, Da Costa JM: анализ генотипа Giardia , выделенных у бессимптомных детей в северной Португалии.Eukaryot Microbiol. 2006, 53 (1): S177-178. 10.1111 / j.1550-7408.2006.00222.x.

    CAS
    Статья

    Google Scholar

  • 29.

    Nematian J, Nematian E, Gholamrezanezhad A, Asgari A: Распространенность кишечных паразитарных инфекций и их связь с социально-экономическими факторами и гигиеническими привычками у учеников начальной школы Тегерана. Acta Trop. 2004, 92: 179-186. 10.1016 / j.actatropica.2004.06.010.

    Артикул
    PubMed

    Google Scholar

  • 30.

    Quihui L, Valencia M, Crompton D, Phillips S, Hagan P, Morales G, Díaz-Camacho SP: Роль статуса занятости и образования матерей в распространенности кишечных паразитарных инфекций в мексиканских сельских районах. BMC Public Health. 2006, 6: 225-233. 10.1186 / 1471-2458-6-225.

    PubMed Central
    Статья
    PubMed

    Google Scholar

  • 31.

    Ваманин Х., Тиллескер Т., Остром А., Тумвин Дж., Петерсон С.: Образование матери, а не образование отца, семейные активы или владение землей — лучший предиктор неравенства в отношении здоровья детей в сельских районах Уганды.Int J Equity Health. 2004, 3 (1): 9-10.1186 / 1475-9276-3-9.

    Артикул

    Google Scholar

  • 32.

    Moreira ED, Nassri VB, Santos RS, Matos JF, Carvalho WA, Silvani CS, Sant Ána CS: Ассоциация инфекции Helicobacter pylori и лямблиоза : результаты исследования суррогатных маркеров воздействия фекалий среди детей . Мир Дж. Гастроэнтерол. 2005, 11 (18): 2759-2763.

    Артикул
    PubMed

    Google Scholar

  • 33.

    Quina M: Helicobacter pylori : португальская сцена. Grupo de Estudo Português do Helicobacter pylori (GEPHP). Eur J Cancer Пред. 1994, 3: 65-67.

    Артикул
    PubMed

    Google Scholar

  • 34.

    Доглиони С., Де Бони М., Сиело Р., Лаурино Л., Пелосио П., Брайдотти П., Виале G: Лямблиоз желудка. Clin Pathol. 1992, 45 (11): 964-967. 10.1136 / jcp.45.11.964.

    CAS
    Статья

    Google Scholar

  • 35.

    Сагар М., Падол И., Хан В.И., Бонин Р.П., Бленнерхассетт П.А., Хант Р.Х.: Создание модели кишечной инфекции на песчанке на основе иммунного ответа Т-Helper-2. Сканд Дж Гастроэнтерол. 2004, 39 (7): 668-673. 10.1080 / 00365520410005315.

    CAS
    Статья
    PubMed

    Google Scholar

  • 36.

    Трауб Р., Монис П., Робертсон И., Ирвин П., Менке Н., Томпсон Р.: Эпидемиологические и молекулярные данные подтверждают зоонозную передачу Giardia среди людей и собак, живущих в одном сообществе.Паразитол. 2004, 128: 253-262. 10.1017 / S0031182003004505.

    CAS
    Статья

    Google Scholar

  • 37.

    Сивила Дж., Фири И., Энемарк Х., Нчито М., Олсен А.: Кишечные гельминты и простейшие у детей в дошкольных учреждениях в районе Кафуэ, Замбия. Trans R Soc Trop Med Hyg. 2010, 104 (2): 122-128. 10.1016 / j.trstmh.2009.07.024.

    Артикул
    PubMed

    Google Scholar

  • 38.

    Махди А., Сурин Дж., Ван К., Мохд-Аднан А., Аль-Мехлафи М., Лим Y: Генотипы Giardia Кишечник : факторы риска и корреляция с клиническими симптомами. Acta Tropica. 2009, 112: 67-70. 10.1016 / j.actatropica.2009.06.012.

    Артикул

    Google Scholar

  • 39.

    Спинелли Р., Брандонисио О, Серио Г., Треротоли П., Геззани Ф., Карито В., Дайчи Н., Дочи А., Пикаку Ф., Дентико П.: Кишечные паразиты у здоровых людей в Албании.Eur J Epidemiol. 2006, 21: 161-166. 10.1007 / s10654-005-5926-3.

    CAS
    Статья
    PubMed

    Google Scholar

  • 40.

    Wongstitwilairoong B, Srijan A, Serichantalergs O, Fukuda CD, McDaniel P, Bodhidatta L, Mason CJ: Кишечная паразитарная инфекция среди детей дошкольного возраста в Сангхлабури, Таиланд. Am J Trop Med Hyg. 2007, 76 (2): 345-350.

    PubMed

    Google Scholar

  • 41.

    Raso G, Luginbühl A, Adjoua C, Tian-Bi NT, Silué KD, Matthys B, Vounatsou P, Wang Y, Dumas ME, Holmes E, Singer BH: множественные паразитарные инфекции и их связь с самооценкой заболеваемости в сообществе сельской местности Кот-д’Ивуара. Int J Epidemiol. 2004, 33: 1092-1102. 10.1093 / ije / dyh341.

    Артикул
    PubMed

    Google Scholar

  • 42.

    Мехрадж В., Хэтчер Дж., Ахтар С., Рафик Дж., Бег М.: Распространенность и факторы, связанные с кишечными паразитарными инфекциями среди детей в городских трущобах Карачи.Plos One. 2008, 3 (11): e3680-10.1371 / journal.pone.0003680.

    PubMed Central
    Статья
    PubMed

    Google Scholar

  • 43.

    Лондоньо А., Мехиа С., Гомес-Марин Дж .: Преваленсия и факторес риесго, занимающегося кишечными паразитами и кишечными паразитами, в районе Зона Урбана в Каларке, Колумбия. Rev Salud Pública. 2009, 11 (1): 72-81.

    Артикул
    PubMed

    Google Scholar

  • 44.

    Nkrumah B, Nguah SB: Giardia lamblia : основная паразитарная причина детской диареи у пациентов, посещающих районную больницу в Гане. Паразиты-переносчики. 2011, 4: 163-10.1186 / 1756-3305-4-163.

    Артикул

    Google Scholar

  • Глазные изменения, связанные с инфекцией лямблии лямблии у детей

    Паразитарное заболевание, известное как лямблиоз, считается сегодня одной из наиболее частых причин гастроэнтерита в мире.1 Болезнь вызывается Giardia lamblia , двуядерным простейшим из подтипа Mastigophora , который имеет четыре пары жгутиков.2 Распространенность лямблиоза варьируется в зависимости от обследуемой популяции, но самые высокие показатели наблюдаются в развивающихся странах и странах. многолюдные городские районы.3

    Инфекционные кисты передаются ротовым путем или через пищу и воду, загрязненные фекалиями.4 Простейшие колонизируют двенадцатиперстную кишку и верхнюю треть тощей кишки, где, как полагают, вызывают прямое повреждение микроворсинок, что приводит к ускоренное обновление эпителия слизистой оболочки и, как следствие, изменение кишечного транзита и всасывания.2-5

    Инфекция часто протекает бессимптомно у взрослых, но симптомы гораздо чаще встречаются у детей, отчасти из-за орально-фекальной передачи, а отчасти из-за незрелости их иммунологических систем.1-6 Первичные желудочно-кишечные симптомы состоят из рецидивов. боль в животе, диарея, рвота и признаки мальабсорбции. У пациентов с лямблиозом также наблюдаются внекишечные симптомы, такие как лихорадка, пятнисто-папулезная сыпь, географический язык, легочные инфильтраты, лимфаденопатия, полиартрит, афтозные язвы и крапивница.6

    Первое описание глазных осложнений у пациентов с лямблиозом было опубликовано Barraquer в 1938 году.7 Этот отчет включал случаи иридоциклита, хориоидита и кровоизлияния в сетчатку. Впоследствии с инфекцией были связаны случаи переднего и заднего увеита и васкулита сетчатки 8–12, а в 1990 г. Петтоелло-Мантовани и др. 13 описали «соль и перец» форму дегенерации, затрагивающую пигментированный эпителий сетчатки у детей, страдающих от лямблиоз.

    В настоящем исследовании мы оценили частоту глазных проявлений в группе итальянских детей с лямблиозом в настоящее время или в прошлом. Чтобы определить, может ли течение заболевания быть связано с появлением и / или серьезностью этих осложнений, эта частота была проанализирована в свете времени постановки диагноза, продолжительности лечения и временного интервала, прошедшего с момента возникновения инфекции. был вылечен.

    Пациенты и методы

    Исследуемая популяция включала 141 ребенка, осматривавшегося в период с января 1994 г. по март 1995 г. в детской гастроэнтерологической амбулатории Медицинского центра Университета Тор Вергата в Риме.У всех было диагностировано заражения Giardia lamblia в период с 1991 по 1994 год. Возраст детей (64 мужчины, 77 женщин) варьировался от 9 месяцев до 13 лет (средний возраст 4,7 (стандартное отклонение 2,0) года). У всех были симптомы со стороны желудочно-кишечного тракта. Ни у одного из детей, включенных в исследование, в анамнезе или в прошлом не было других инфекций или метаболических заболеваний, и никто никогда не лечился хлорохином, тиоридазином или хлорпромазином, которые, как известно, вызывают глазную токсичность.

    У детей младше 3 лет диагноз лямблиоза ставился после того, как паразит был изолирован как минимум из трех свежих образцов стула (собранных за 3 часа или менее до исследования).У детей старшего возраста (то есть от 3 лет и старше) диагнозы основывались на исследовании дуоденальных выделений, собранных с помощью системы Enterotest (HDC Corporation, Mountain View, CA, USA) .14 Все пациенты прошли микробиологический скрининг на следующие патогены: Salmonella , Shigella , Campylobacter , Yersinia , Escherichia coli , ротавирус и аденовирус, 15 Если какие-либо патогенные микроорганизмы, отличные от Giardia lamblia , были исключены из исследования, пациент был исключен.

    Исследуемая группа была разделена на три подгруппы. В группу A вошли 53 ребенка (средний возраст 4,1 (SD 0,3) года), которых обследовали сразу после постановки диагноза до начала лечения. В группу B вошли 50 детей (средний возраст 4,0 (0,5) года), у которых был диагностирован лямблиоз за 12 месяцев или более до нашего исследования. Несмотря на два или более циклов лечения (метронидазол 5 мг / кг три раза в день в течение 7–10 дней), у всех этих детей на момент нашей оценки были получены положительные образцы стула.Группа C состояла из 38 детей (средний возраст 5,8 (0,8) года) с инфекциями Giardia lamblia в прошлом, которые успешно лечились одним или несколькими курсами терапии метронидазолом. При последующих наблюдениях продолжительностью от 1 до 3 лет периодические исследования образцов стула не выявили никаких признаков простейших.

    В исследование также была включена контрольная группа, состоящая из 300 детей, выбранных из тех, кто посещал нашу амбулаторную клинику в тот же период, что и исследуемая группа.Все они были из одного географического района и имели социально-экономические характеристики и особенности питания16.
    17похожи с таковыми в исследуемой группе. Мы исключили из контрольной группы всех детей, имевших положительный анамнез на инфекционные заболевания (кроме инфекций верхних дыхательных путей) и нарушения обмена веществ. Их также никогда не лечили хлорохином, тиоридазином или хлорпромазином, которые, как указывалось ранее, вызывают глазную токсичность. Сто пятьдесят из этих детей (77 мальчиков, 73 девочки в возрасте от 11 месяцев до 14 лет; средний возраст 4 года.7 (2,1) года) не имел никаких желудочно-кишечных симптомов; остальные 150 (76 мужчин, 74 женщины в возрасте от 9 месяцев до 14 лет; средний возраст 4,7 (1,9) года) страдали пищевой аллергией, глютеновой болезнью, гастроэзофагеальным рефлюксом или детской диареей и имели такие симптомы, как диарея, рвота и / или боль в животе. Все контрольные субъекты были отрицательными на лямблиоз на основании микроскопического исследования образцов кала (три образца) и / или дуоденального секрета, исследованного не менее трех раз в течение 3 месяцев.

    Все дети как в основной, так и в контрольной группах прошли офтальмологическое обследование, которое включало измерение остроты зрения, исследование моторики глаз, исследование передней камеры с помощью щелевой лампы, а также прямое и непрямое офтальмоскопическое исследование глазного дна после индукции мидриаза циклопентолатом. .

    Все дети в основной и контрольной группах независимо обследовались двумя офтальмологами. Первый (AC) знал о включении ребенка в исследование, но не знал о его / ее групповом происхождении (то есть о случае или контроле).Затем они были осмотрены вторым офтальмологом (CN), который не знал о характере нашего исследования или статусе случай / контроль ребенка. Глазные изменения были диагностированы только при обнаружении обоими исследователями. Электроретинография (ЭРГ) также выполнялась всякий раз, когда наблюдались изменения глазного дна.

    Результаты

    Обследование остроты зрения в группе с лямблиозом показало, что средняя ошибка рефракции составляет -1,0 (SD 0,5) D. Исследования моторики глаза и исследования передней камеры у всех 141 ребенка были без особенностей.Изменения в эпителии сетчатки, соответствующие внешнему виду соли и перца (рис. 1A и 1B), были подтверждены обоими офтальмологами у 28/141 (19,9%) ребенка (15 мужчин, 13 женщин; средний возраст 3,5 (0,4) года) (Таблица 1 ). Три других случая были исключены из анализа, поскольку результат был зарегистрирован только одним из экспертов. Эти поражения представляли собой точечные участки гиперпигментации на фоне более светлого глазного дна. Изменения были более выражены в средней периферии верхнего и нижнего квадрантов сетчатки.В 25 из 28 случаев вовлечение было двусторонним. У 20 из этих детей поражения можно было визуализировать как при непрямой, так и при прямой офтальмоскопии. У остальных восьми изменения сетчатки выявлены только при последнем обследовании. Электроретинограммы у всех 28 детей были нормальными. В одном случае оба исследователя отметили дополнительное повреждение сетчатки, которое могло быть связано с перенесенным хориоретинитом.

    фигура 1

    (A) и (B) Фотографии, показывающие типичный «соль и перец» внешний вид сетчатки.

    Таблица 1

    Заболеваемость дегенерацией сетчатки «соль и перец» (СП) у пациентов на разных стадиях инфекции и терапии

    Одиннадцать (39,2%) из 28 детей с поражением сетчатки были из группы A, 10 (35,7%) из группы B и семь (25%) принадлежали к группе C (Таблица 1). В группу с изменениями сетчатки также вошли пять пар братьев и сестер. В некоторых случаях из последней группы инфекция была диагностирована за 3 года до нашего исследования. В таблице 1 показан возраст 28 детей с положительными результатами и возраст детей с нормальным осмотром глазного дна.Во всех трех подгруппах дети с поражениями сетчатки были значительно моложе детей без поражений (p <0,05, тест Стьюдента t ), а распространенность положительных результатов была прямо пропорциональна среднему возрасту в подгруппе. Не было различий между тремя подгруппами в отношении клинических характеристик или степени поражения сетчатки. У пациентов с активными инфекциями (группы A и B) не было корреляции между количеством фекальных паразитов и наличием поражений сетчатки.

    У 300 детей контрольной группы ни один из исследователей не обнаружил поражений сетчатки, подобных тем, которые наблюдались в группе с лямблиозом.

    Обсуждение

    Связь между инфекцией Giardia lamblia и глазными изменениями была описана рядом авторов.7-12 В 1990 году Pettoello-Mantovani et al. описали восемь случаев дегенерации сетчатки с солью и перцем в группе из 90 детей с активным заболеванием. лямблиоз (8,8%) .13 В нашем исследовании, проведенном на еще большей популяции пациентов с лямблиозом у детей, процент детей с такими заболеваниями сетчатки был еще выше (19.9%), что может отражать более молодой возраст изучаемых нами детей (в среднем 4,7 года против 6,9 года в ранее процитированном исследовании). Более высокая частота, выявленная в нашем исследовании, также может быть связана с тем, что мы используем как косвенную, так и прямую офтальмоскопию. Более высокое увеличение, которое может быть достигнуто с помощью последнего подхода, часто необходимо для обнаружения тонких изменений, которые характеризуют этот тип изменения сетчатки. Фактически, более четверти детей с поражениями солью и перцем показали нормальные результаты непрямой офтальмоскопии.

    Типичное поражение солью и перцем представлено точечными участками нормальной или гиперпигментации на более светлой, желто-розовой сетчатке.18 У обследованных нами детей поражения были более заметны на заднем полюсе, где они были распределены по дорожкам сетчатки. основные кровеносные сосуды. Эти поражения отличаются от поражений более тяжелого заболевания, известного как пигментный ретинит, при котором пигментные гранулы обычно распределяются в виде остеобластов вокруг кровеносных сосудов.18 Считается, что поражения солью и перцем вызваны повреждением или некрозом клеток пигментный эпителий сетчатки (клинически представленный более светлыми участками сетчатки) с высвобождением пигментных гранул, которые мигрируют в более глубокие слои сетчатки, где их можно увидеть в виде черноватых точек.18

    Подобные результаты были описаны и при других заболеваниях, включая цистиноз и различные типы инфекций (например, врожденный сифилис, краснуху, токсоплазмоз и онхоцеркоз) .18 Также сообщалось о применении противомалярийных препаратов, фенотиазина, йодированного вещества и оральные контрацептивы19.

    Механизмы, лежащие в основе глазных поражений, связанных с лямблиозом, в настоящее время неясны. Хотя микроскопические исследования тканей глаза никогда не проводились, большинство авторов исключают возможность прямого вторжения паразита.Действительно, простейшие никогда не были изолированы от каких-либо поражений, вызванных этим заболеванием, включая крапивницу, которая является проявлением, наиболее сильно напоминающим артериит сетчатки и воспаление глаз, наблюдаемое у пациентов с поражением глаз. Изменения сетчатки, связанные с лямблиозом, более чем вероятно вызваны иммунными механизмами. Ваниа сообщил, что циркулирующие иммунные комплексы были обнаружены у всех обследованных им пациентов с глазными осложнениями.20 Кроме того, гистологическое исследование крапивницы, вызванной лямблиозом, показало наличие инфильтратов, состоящих из полиморфно-ядерных клеток, лимфоцитов и эозинофилов.10 Возможно, маленькие дети более восприимчивы к этому типу повреждений из-за незрелости клеток эпителия сетчатки. Эта гипотеза совместима с нашим наблюдением более высокой частоты глазных осложнений среди детей младшего возраста во всех трех подгруппах в настоящем исследовании.

    В группу пациентов с ретинальными проявлениями вошли пять пар братьев и сестер. Последние сообщения связывают лямблиоз с некоторыми истотипами HLA21; поскольку дегенерация пигментированного эпителия сетчатки часто передается генетически, 18 поэтому возможно, что появление осложнений на сетчатке частично зависит от генетической предрасположенности.

    Анализ данных из подгрупп A (нелеченные, недавно диагностированные инфекции) и B (длительные инфекции, резистентные к терапии) не выявил каких-либо существенных различий в отношении распространенности или тяжести обнаруженных поражений сетчатки. Это открытие предполагает, что развитие этого типа изменения сетчатки не зависит ни от тяжести, ни от развития инфекции. Более того, наблюдение поражений сетчатки в группе А (дети, которые вообще не лечились) подтверждает предыдущие сообщения о том, что метронидазол не влияет на появление или развитие этих поражений.Изменения сетчатки обнаруживались с одинаковой частотой у детей группы C, чьи инфекции были успешно устранены за 1–3 года до нашего исследования, что указывает на то, что поражения сетчатки не прогрессируют (или не регрессируют) со временем.

    Эти поражения, по-видимому, не вызывают функциональных изменений сетчатки, поскольку результаты электроретинографии были нормальными у всех детей с поражениями сетчатки, хотя этот вывод должен быть подтвержден в ходе длительного наблюдения. Однако отсутствие изменений ЭРГ также важно с диагностической точки зрения, поскольку оно отличает изменения соли и перца от прогрессирующих форм эпителиопатии сетчатки, которые имеют худший прогноз.

    Результаты этого исследования демонстрируют, что структурные изменения пигментного эпителия сетчатки являются наиболее частыми окулярными находками у педиатрических пациентов с текущим или перенесенным лямблиозом. И офтальмологи, и педиатры должны знать об этой связи при интерпретации результатов исследования сетчатки у детей, особенно тех из регионов, где инфекция носит эндемический характер.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *